GenePrediction:GLEAN_6532 Details

Name: GLEAN_6532
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_168:238462..237793 (- strand)
Length: 670
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_168:238462..238450 (- strand)
Length: 13
Type: CDS
Source: GLEAN
Position: GCSC_168:238349..237793 (- strand)
Length: 557
>GLEAN_6532 class=GenePrediction position=GCSC_168:238462..237793 (- strand)
ATGGCTGATAAAGGTGAGTGCGAAGCAAGCATAGATCTGTGTGCGCTTCTTGGAGCCAGACCTTTGACCTCTCTGCAACG
CATCTTCTTCCACCGCATCGGCTAACCCGCCAGAACTCACCCCCGCCGAGGAGGCAGCTGTCCGCGCCAAGGAGGCAGCC
GAGCAGGCGGCGCTGCCGTACAAGTGGACGCAGACGATTGCCGACCTGGACGTGGCGGTGTCGTCGATCCCGGGCAACCT
CAAGGCGCGCGACCTCGTGGTCGAGATCAAGCGCGACGCCATCACCGTTGGCATCAAAGGCCAGCCGCCCGTGGTCACCG
GCGCGCTCTTCCGGCCCATCCTGACGGCCGACTCGACCTGGACGCTCAGCGGCAACGCCGACGGCACCAAGACGATCGAG
GTCCACCTCGACAAGACCAACAAGGCCGAGTGGTGGCCGCACGTCGTCACGTCCGCACCCCAGATCGACGTCACCCGCAT
CCAACCCGAGACGTCCAAGCTGTCGGATCTCGACGGCGCCACCCGTGGCATGGTCGAGAAGATGATGTACGACCAGCGCC
AGAAGGAGCAGGGCAAGCCCACGTCTGACGAGCAGAAGAAGCTCGACATCCTCAAGAAGTTCCAGGAGCAGCACCCCGAG
ATGGACTTTACCAACGCCAAGATCAGCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62