GenePrediction:GLEAN_6534 Details

Name: GLEAN_6534
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_168:229460..227195 (- strand)
Length: 2266
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_168:229460..229431 (- strand)
Length: 30
Type: CDS
Source: GLEAN
Position: GCSC_168:229365..229305 (- strand)
Length: 61
Type: CDS
Source: GLEAN
Position: GCSC_168:229235..228244 (- strand)
Length: 992
Type: CDS
Source: GLEAN
Position: GCSC_168:228166..227195 (- strand)
Length: 972
>GLEAN_6534 class=GenePrediction position=GCSC_168:229460..227195 (- strand)
ATGTTCCACCAGCAGCCCTTCGTGGAGCCTGTCTGTCTTGCCGACTTCGCGATGCAGCAGGGCCGAGAAAGCTGTCGACG
ACGACGCAACGAAAGCAAAAGGCGACTGGCAGAGCGGCACTGTCGGAGAGCCAATGGGACGAGTATAAGCAGAGCTGTAG
GTGACAACGGAGGCAGCTGCGGCCCTGATCCTGCGAGCGAAGACAGGTTTCTGACGCAGCGACAGTTGACTTCCCGCGTG
CTTCCAGCGCAGACGAGTTCGAGGTGGGCCGGACGGTGACGGTGCACGGCTTCCTAGGGCGGCGGCGGGACATTTCGGCG
CGGGCGAGCTTTGTGGACGTGGTGCGTCCGGGCGAGCCACAGCCGATCCAGCTGCACTCGACGTGGGAGGCGGAGGGCAA
CAGCGGCGCCGAGACGACGCACGCGCAGCTGCGTGCAGTGCCGCCGTACAGCGCGGTCTGGGCGACGGGCACGGTGGTGT
CTGTGCCCGACAGCCAGGGCAAGGCTGGCGAGAAGGTGCTGGTGCGGCTCGCGGCCATACAAGTGCTCAGCCGCTTTCCG
CGCGACATTGTGGTGTCCAAGGGCGCCGTCTTTCCAGCAACGGCACGCCACCTGCAGATGCGCTTCTCGGCGGCGCTACA
GCGGCGACTGGCCTTCCGCAGCGACGTGGCCGACCGGCTGCGACAGCTGCTGACGGGTGCGGGCTTCCGCGAGTTCGAGA
CGCCGCTGCTGTTCAAGTCGACGCCTGAGGGCGCGCGCGAGTTCGTGGTGCCGACACGGCGTCGCGGCTGGGCCTATGCC
CTGCCCCAGAGCCCGCAGCAGTTCAAGCAGATGCTCATGGCCTCGGGCGTGGCCGCGTCCTACTTTCAGTTCGCCCGCTG
CTTCCGCGACGAGGATCTCCGTGCCGATCGTCAGCCCGAGTTCACCCAGCTCGATCTCGAGATGGCCTTTGCCACGGGCG
AACACGTCATGCAGACCGTCGAGCAGCTCGTCCGCGACCTCTACTGCCACATCCAGCAGACGTACGTGTTGGCGCCCGCT
GGCATCGGCAGCGCGGACGAGAGTGGCCTCGTGCCCACGCCGCATTCCGAGGCCCCTACATCCGGTGACGCCGTTCCCTA
CGCGACCCTGCCGGACGAACCGTTTCGGCGCATCTCGTACTACGAGGCCATGGCCAAGTACGGGTCGGACAAGCCGGACC
TGCGGATACCAGGAGAGGTGGGTGCGGCGAGATGAGAGAAAAGAGAAAAAAAAAAAAAAGAAAGAAAACAAGAGACAACT
GCTAACACCAACAGATCCACCAAATCGACCACTTTCTGCCAAAGACCTTTACCAGCATGATTTCTGACCTGGCCGACCCT
GTCGTCGAGGCCGTGCGGCTGCGTCTGGACGGCAGCCCGCGCGCGAACCGCGACTTTGTGCGCCGACTATTTGACAGCCT
GCCGCCGACCCTGGGCCAGAACCCGGACGGCCAGCCGGCCGTGCTGCTGTTTGATGCGAGCCAGCCACTGAGCGGGCTAG
CCGCGCTAGGTCATGAGGCCGCGGCGACGCTAGGGGTCGAACTGGGCGGTCTGGAGGACGGGGACGTGGTCCTGCTGCAG
GCACGCCGACGCGAGCCTTTTAGCGGTGGCTCGACCGCGCTGGGCCAGCTGCGCCTCGAGGCGTGGCGGGCGGCCGTGGC
GGGCGGTCTGCTTGAGCCGGATCACCGCTTCTGCTTCGCCTGGGTCGTCGGCTTCCCCATGTTTACGCGCGACGTCGACA
CGGCCTCGGAGCCGGGCCAAGGCGGCCATGCCGGCTTCTCGGCCACGCATCATCCGTTCACGGCGCCGCTCACGACGGCC
GACCTCGATCTGCTCGCTACCGATCCGCTTCGAGCCCGCGCTGACCACTACGACCTCGTCGTCAACGGCGTCGAACTCGG
CGGTGGCAGCCGTCGCATCCACGTCGCTGCCGTCCAGGAACTCGTTTTGCGCCACGTCCTCCAGATGGACGACGCCGGCG
TCGCCCAGTTCGCTCACCTGCTCGCCGCCCTGCGCGCTGGTTGCCCCCCCCATGCTGGAATGGCCCTCGGCTTCGATCGC
CTCGTCGCCCTGCTCGCCGGCACGCCGTCCGTCCGCGACGTCATCGCCTTCCCAAAGAGTATGAAGGGCGAGGACCTCGC
CGTGCGCAGCCCCACCCGACTGACTGCTGCCCAGCTCGAGACGTACCATCTGGCGGTGCGGCCGGCCGCAGACAAGGGAA
AGGACGCAGAAAAGGGTGCAGAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62