GenePrediction:GLEAN_6535 Details

Name: GLEAN_6535
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_168:226681..225481 (- strand)
Length: 1201
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_168:226681..226535 (- strand)
Length: 147
Type: CDS
Source: GLEAN
Position: GCSC_168:226403..225561 (- strand)
Length: 843
Type: CDS
Source: GLEAN
Position: GCSC_168:225489..225481 (- strand)
Length: 9
>GLEAN_6535 class=GenePrediction position=GCSC_168:226681..225481 (- strand)
ATGGCCGACCGAAGCGTTGAGCGCGAGCTCACGTCGCGCGTCAAGGCGCTGAACAAGGCGATTGCGTCCAACGAGCCGGC
GCACAGCATCCTGGCCATCATGGAGACGCTGAAGAAGGCGGTGGCCCCGACGGAGGATGTGCTGCGGGTGGGTGTTTTCT
TGGGGGCATATGTTCTTTTTGTTCTTTTCTCGTTCTTTTTTCTTTTCTTTTCTTTGTTTTCTTTTCTTTGTTTTCTTTTT
CGTTTCTCTTTTCTTCGTCCTCCTACTAACTTCCCCAGTCAACTCGTGCCGGCCATACGGTCGGCAAGCTGCGGGCACAC
GCCAACCACGAGGTCAAGTCGATGGCCACGGAGATCGTGACCAAGTGGAAGAAGGCGGTGGAGCTGGAGAAGAAGCGATC
GGGCGGCGCTGCGGCGAGCAAGCGGGCCTCGCCGGCCAACCACAGCAGCAGCACGGGGACGCCGCAGCGCAGGGGCACGA
CGTCGCCAGGACCGGCCGGACCAGACGCGCGAGCCGAAGCCAAGTCGACGGCAGCAGCTCCGGCTGTGGCGGCGTCATCC
GGCACAGCGACAGCCTCGTTCCAGGGCGATCCCGACAAGCGCAAGTTTGAGACGGACGGCGTGGACGTCAACCGGACGGG
CGTGCAGAGCCGCGACAACTGCATCGGGCTGCTGTACAACGGGCTCGCGTTCCGGTCGACAGAGCTGCCGGAGCGGGTGC
TGGCCAAGGCGATCGAGGTCGAGAAGGCGGCCTTTGTGGTGTACAAGGGCGAGACGGCCGAGTATCGGGCCAAGCTGCGG
TCGCTCTTCCAGAACCTCAAGAACCGGTCGAACCCGGCGCTGGGACGACGCGTGGTCGCGGGCGAGATCGCGGCTGACGC
CTTTGTCGTCATGTCGTCGGACGAGCTCAAGTCGGCCCACCTGAAGCAGCTCGAGAGCGACCTCCAGAAGGAAAACATGA
AGAAGGCCCAGGTGCCGATGACGGAAAAGTCCATCAGCGACGCCCTGACCTGCGGCAAGTGCAAGCAGCGCAAGGTCAGC
TACACGCAGGCGCAGACGCGCAGCGCCGACGAGCCCATGACGACCTTTTGCGAGTGCACCGTGTGCGGCCACCGATGGAA
GGTGAGTTGGACTTGGCTTGGTGGTGTGGATAGCTGGTGTCCCGTGACCGGAAGACTGACAAGCGTGCCTAGTTCTCGTG
A

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62