GenePrediction:GLEAN_6538 Details

Name: GLEAN_6538
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_168:210805..209536 (- strand)
Length: 1270
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_168:210805..210499 (- strand)
Length: 307
Type: CDS
Source: GLEAN
Position: GCSC_168:210092..209801 (- strand)
Length: 292
Type: CDS
Source: GLEAN
Position: GCSC_168:209728..209536 (- strand)
Length: 193
>GLEAN_6538 class=GenePrediction position=GCSC_168:210805..209536 (- strand)
ATGTATGAGCTCGTTGGTGCAGACGAATACCAGTATTCTGGACCTGAAGTGCCATATGTTCTCGACCTGATCCCACTAGC
CTCAGGTCTGGCTGCGATATCATCGGACGGAAGACTGTCTCTGTTCGACCCGCTTCGTGTGGGCAGTGGCCCAAATCGCA
CCTTTCAGACGTCCCATGGCAATCTCACAACGGCAAAGGCCCTGGATGCAGCCGGCTGTGTCCTAGCTACGGCTGGTGAG
AACGGCACGGTATCCCTGTGGGATCTGCGCGACTCGGCACAAGGACCAGGGGTCACCGTCCAGGTTGGTGAGTGATCTTC
AACTTCTCCCGAGGCGGCTGCATCAAACAGCATATATAGTGTACTAAACAGCACTTCTTCCAGGCTCTTGTGATGCCAAC
ATATTGTCGCTTGCCTGTGAGCCACAGAGCCAGTCTATCGCCGCAGGGACAGAACTTGCTGGCTATCAAGCCTCAATCGT
GATCTGGTATGGCCTTTCTTTCTCTCGTTCCCTCCTCCACTAACAATGGCTCTCAGGGATGTCAGGGCCGGCACCTCCCC
GAAAGTCAGTTACAATGACGTTCACAGTGACGATGTGACAGAAGTATGTCTATCTCTCATGAAAAAAGCCCAGTGGTGGG
GATGTTTAGCTAACAGCTAGAAAGCTGGCCTTCCACCCACGACACAATCATGTACTCTTGTCCGGCTCTACAGACGGCTT
GGTGAACATATGTGATACCCGGATAACAGATGAAGACGAGGCCGTCATTCAGGCTTTCAACCACGGAGCCTCAATCCACC
ACGCAGGCTTCCTCAGCGACAGCGAAGTATACGCGCTGTCACACGACGAGAAGCTGGCCATGTACGATATGGCCGAAGAG
CGGGAAGCAGGCTCTGCCACTAAAGACTTTGGGGATACGCGACAGACACTGGGCTGCCAATACGTTGCCAATATGCTACC
AAAGGCAGGATTCACTGGGGCCGTGCTTGGAGCCGGAGCACAAGAGTATGTATCTGTAAAAGAGCCCGAAGACATAATGA
CACATGTTGTTTATATTCTTCGACTAACACTCTTTAGTGCGGGGATGTTTAAGCTAGTCCATTTGTCCAAACACCAAGGA
TGGGGGGTTGATTTAGAATCTGTTGTCGGCCTTCCCGGTGCTCATGGCTCAGATATCGTTCGCGGTTTCTGTGTCTTCGA
CGAGCAGCAGGTTGTCTACACATGCGGAGAAGACGGCAAGATCAGGGCATGGAGGCCGCCATTGTCGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62