GenePrediction:GLEAN_6539 Details

Name: GLEAN_6539
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_168:208310..205167 (- strand)
Length: 3144
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_168:208310..208291 (- strand)
Length: 20
Type: CDS
Source: GLEAN
Position: GCSC_168:208234..208092 (- strand)
Length: 143
Type: CDS
Source: GLEAN
Position: GCSC_168:208017..205778 (- strand)
Length: 2240
Type: CDS
Source: GLEAN
Position: GCSC_168:205718..205167 (- strand)
Length: 552
>GLEAN_6539 class=GenePrediction position=GCSC_168:208310..205167 (- strand)
ATGGATGACCTTTACGACGAGTACGGCCAGTCCCTACGTGTGATTTTATATACCCTTGCTCTAACATTGTGATCAGATTT
GGCAACTTCATCGGCGAAGAGCCCGAGGGGTCTGAAGAAGGATCTGAGCAGGCCGAGGCCGAGGCCGACAACTATGGCTA
CGATGACGAGGATGCGGGAGGCGCAGAGGGCGTTGGTCAGGAGTTAATGGAAATGGATGGTAAGGATCCCAGGTGGCGCA
CTGGATGCACAATGCTTGGGCTGCTAATGACTGATTTGTCGTCGGTTCTGTAGATGACGGACCATCGAATGCTGTGATCC
TTCACGAGGACAAACAGTACTATCCGACAGCAGCACAAGTATACGGGTCAGAGGTGGAGGCCCTGGTGCAGGAGGAGGAT
GCGCAGCCACTGTCGGAGCCGATTGTGGCGCCGGTCGAGCAGAAGAAATTCAGCGTGGAGGAGGCCGATCTGCCACGCGT
TTTCTTCGACCGGGGGTTCATGACGGACCTGACGAACTACCCGGAGCAGATACGAAACGTTGCGTTTGCCGGGCAGCTGC
ACCACGGCAAGACGGCCTTCATGGACATGCTCGTGCTGGAGACACATGATATTGCCGAGCGGCTAGAGCAGCGATCGGGT
CGGCGACGAGACGAGCAGTTGCGGTACACGGATGTGCACATTCTGGAGCGAGAGCGGGGGGTGTCGATCAAGAGCGCGCC
GATGAGCCTGGTGCTGCCAACGACGAGAGGCAAGTCGCATCTGATCAACATGATCGACACGCCTGGCCACGTCAACTTTG
CGGACGAGGTGGCAGCAGCTCTGCGGCTGGTGGACGGCCTCTGCCTGGTGGTGGATGTGGTGGAGGGCGTGCAGCTGCAC
ACGGAGATGATCATACGACACGCGGTGCTGGAGGACCTGCCGCTGACGCTGGTAATCAACAAGGTGGACCGGTTGATTCT
GGAGCTCAAGCTGCCGCCGGCGGACGCCTACTACAAGCTCAAGCACACGATCGAGGACGTCAACCGGGTGATTGCAGAGA
CGATGCCAGGGCCGATCGATGCGAAGCGGGTAAGCCCGGAGAAGGGCAACGTGCTGTTTGCGTGCACGAGTCTGGGCTGG
TGCTTCACGCTGCCGTCATTTGCCAAGATGTACGCGGACAGCTTCGGGGCGATGGACGTGGACGAGTTTGCGCGGCGGCT
GTGGGGCGACGTGTTCTTCAACCCGAAGAAGCGGTCGTTTACGCGCAAGGCGGTGGAGGCAGAGGCGAAGCGGTCGTTTG
TGCACTTTGTGCTAGAGCCGATCTACAAGCTGTTCACGCACACGATCAGCGAGAGCCCGCGCGAGCTCAAGGTGTTTCTG
GAGCAGCTAGGCATCGTGCTGAAGCCGTCGCAGCTGCGGGCCGATGCCAAGGTACTGCTGAAGCTGGTGTGTGAGCAGTT
CTTCGGGCCACCGGCAGCGTTCGCAGACATGGTGGTCAAGCACGTGCCGTCGCCGGTGGAGGCAGCAGCACGACACCTGC
AGCGGTACTACACCGGGCCGCTGGACAGCAGGGTGGCACGGGCGATGGAGACGTGTGACCAAGACGGGCCGCTGGTGGTG
GAGGTGACGAAGCTGTTCAGCTCGAGCGACGCCAAGAGCTTCAACGCGCTGGGACGGGTGCTGAGCGGCATTGCGCGGCC
AGGCATGGAAGTGCGGGTGCTGGGCGAGGGCTACTCGCTGGACGACGAGGAGGACATGGCGCCAGCGCGGATTGCCGACG
TGTGGATCGCGGAGACGCGCTACAACATCGCGACAGACGGCGTGCCGGCGGGCAACCTGGTGCTGCTGGGCGGAGTGGAC
AACTCGATCGTCAAGTCGGCGACGGTGGTGGCACGGCGGTTCGACGAGGACGAGGACGCGTACATCTTCCGGCCGGTGAC
GCACTACACAGAATCGGTCTTCAAGGTGGCCGTGGAGCCGGTCAACCCATCGGAGCTGCCGAAGATGCTGGACGGCATCC
GCAAGATCAACAAGAGCTACCCGCTGGTAACGACCAAGGTCGAGGAGTCGGGCGAGCACATCCTGATCGGCACGGGCGAG
CTATACATGGACTGCGTCATGCACGACCTGCGGCTGCTGTACGCCGACATGGAAATCAAGGTGTCAGACCCGCTGACGCG
CTTCTGCGAGACGGTCGTGGACGAGTCGTCGACCAAGTGCTGGACCACCACGCCCAACAAGAAGAACCGCATCACCATGG
TGGCCGAGCCGCTGGAGGACGGGCTGGCCCGCGACATCGAGACGGGCGCGGTGCGCATCCGGGATCCGGTGCGGAAGACG
GCCAAGTTCTTCCAGGACAAGTACGACTGGGATCTGCTGGCCGCCCGCAGCATCTGGGCCTTTGGGCCGGAGGAGAACGG
GCCCAACATCCTGCAGGACGACACGCTGCCAGGCGAAGTCGACAAGAAGCTGCTCAGCACGGTCAAGGAGTCCATCCGGC
AGGGCTTCAGCTGGGCTGCCCGGGAGGGACCTCTCTGCGAAGAACGCAAGTTTGTCCCCACACTGTTCCGAGTAAAGTCC
GAGCTAACAAGGCAGCGATCCGCAACACCAAGTTCAAGCTAATGGACGTGTCGCTAGCCCAGGAGGCCATCTACCGCGGC
GGCGGCCAGATCATCCCGACGGCGCGTCGAGCCTGCTACGGATCTTTCTTGCTGTCATCGCCGCGGCTGATGGAGCCGGT
CTACCAGGTCTCGATGACGGGTTCGGGCAGCGCGTCCAACGAGCTCTACAATTTGCTGTCGCGGCGGCGTGGTCACGTGC
TGACCGATGTCTCGGTAGCCGGCACGAACCTGTCACGCGTCACCGGGCTGCTGCCGGTCATCGACTCGTTTGGCTTCGAG
ACCGACCTGCGCATCACGTCCAAGGGCGCTGCCTTGGTCAGCATGGTCTTTGACCGCTGGCAGGTCATCCCGGGCGACCC
GCTCGACAAGGACGTGGTGCTGCGGCCGATGCAGATGGCTAGCGTGCAGGCCACCGCCCGCGATTTTGTGCTCAAGACGC
GGCGCCGGAAGGGCCTCAGCGAGGACATCGCCACCGGCAAGTTTCTCGAGCCGGAACTGTACCGGGAGCTGGTCGAGAGC
GGCATCCTCACTGAAGGATCCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62