GenePrediction:GLEAN_6540 Details

Name: GLEAN_6540
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_168:197668..194189 (- strand)
Length: 3480
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_168:197668..197554 (- strand)
Length: 115
Type: CDS
Source: GLEAN
Position: GCSC_168:197397..197320 (- strand)
Length: 78
Type: CDS
Source: GLEAN
Position: GCSC_168:196905..196312 (- strand)
Length: 594
Type: CDS
Source: GLEAN
Position: GCSC_168:196181..195900 (- strand)
Length: 282
Type: CDS
Source: GLEAN
Position: GCSC_168:195841..195288 (- strand)
Length: 554
Type: CDS
Source: GLEAN
Position: GCSC_168:194769..194576 (- strand)
Length: 194
Type: CDS
Source: GLEAN
Position: GCSC_168:194507..194189 (- strand)
Length: 319
>GLEAN_6540 class=GenePrediction position=GCSC_168:197668..194189 (- strand)
ATGACGAGTGACGACGCCACTGCGAGGCGGCTTCTGCCCCAGAGCTCGCAGATGAGCTCCTTCTCTTTCACCCCTCCGGC
CACGTTCCAGCAACCAAGAGAGACACAACAGCGAAGTGAGTGCCTCGTTCTTCACATCCGCGGAGCATGGCAGTAGGATA
GCAGAGAATGCCGGACACCAAGGACACTTGGACTTTCGATTATCTCTGTCCTGGCTACTAGCTACCGAAACGACGTCTGG
GGACGCCTTCCGTATCTAACCCGTCTTGCAGATTATGTCTTCGTTGACGAGCACAATCGCCACAAGAGGTTAAAAGGTAA
GGTCGCAACATGGCCGTTGCGCCGTGAGCGTAAGTGGGCGAGAAAATGCTGACATATTTTATGGTCTGCAGTCATGAGAG
CTTGTGAAGGTTGCCGAAGGAGGAAGATCAAATGCGACGCAGCTACGACAAATACATGGCCTTGCTCGGCTTGTGTGCGA
CTGAAGCTTCAGTGTATTCGCCCGACTGGATATGATGATGCTTCTGATACGCAAAGCTATGACGACCAGCCTCAAGTACA
GCAGCAGCAGCAGCAGCAGCAGCAACCTCCACAGCAGCCGCCCCCACAACAGCCATCACAACAGCATCAGCTGCAGCAAC
AGCCGCAACAGCCGCAGCAGCAGATGTACGGCCGCACCATCGACTTTCAGCATCACCAAATGGATCCTACAACGGTCATT
GACACCAAGCCTGCGCTCTACGCTACACGAACGGCACCTGCAGATTACTCAACAGTACCAGTAAATTCTGGTGCCTCTAA
TGCTGCCCTCTATGCTCGAGTGCCGTACGGGGAATCTGCTTCTACTCTTCAATACACGACTGTGCCGCCGTCAATGCCCA
GTGTGGAAACAGTGTACACAGGCCAGCAAAACGTATTTCCCACTCCACCAATGCAGCATAGCTCTCACACCGAGTCACCT
CCCGATTCTGCATATATCACCGATGAGCAGGCTGCGTATGGCAATGCAGATCTAGCCGATCTTCTAGGCAGCTTGCGTAT
GAACGAGGCCGGGACAGCACCATACTTGAACAACCGCATACTAGCAAGCAAACGAGACAACGAGACGCCTTTGGCTGACG
ATGACGATGATTACAAAAGCTCACTGCCTCCGCTAGTGGCTGGCCCCGGCCTCAAGATCCGGATTCCTCCCGAACTTATG
CCTGACGATGAAACTGCACAGCATTACTTTGATCTCTACTTTGAAAATGTTCATCCCTTCGTTCCTGTCTTGGATAAGGC
CGCATTCTACCAACAATGGCACACGGACAGGGAATCTATATCCCCGCTCCTCATTGAGGCTCTCCTGTCCATTGGAGGTC
GGCTTGGGCAGACGAGCCGTCCCAAGGACAGCAGTGGCTTGCTTTGGCGACAAGTACGTGTCCCGCCCCTGTTGCCCGCA
TTGTTCCCGAGACATGTCCCACAATGTTCTGACTGGTCGGCATTTAGGACATGCTGATTCGTTTATGGATGTTCCACGAT
TGAGCACGCTGCAAGCTCTCCTCGTCATGCTGAAAGCACGCGAAGCTGCCCCCAAACGCGGCTACTACTACCGGTCGTGG
ATGGCCATTGTCCAGTGTGTGCAGATGGCTAAAGATCTTGGACTTGACGAGCATTATGCCGACCATGAAGCCGGCCATCC
ATGCGGTTCAAGCCCCTCTGAGTGTCTTATGAAAACTCGCATCTGGCAGACAACCTTTATCTGCGAGGTTATGATCGGGT
CACCCCAAGGTAAGGGACTGTCTTATGAACGGTCCTACTTTGCCGGCGCTCGTTGCTAACTGAAAAGGCCGGACGGACCT
TACTGTGACAGTAGACTCGGTAGATTTGCGAGAACCGCCACATTTACAAGGCGTGGACGAGGCGGAGATACTGATATCTC
GAAACTTCGTCTACTTTGTCCGTGTCGTCTCGTACATTTCCCGGATGAACAGAGTATACGCACGAATCAAGAGGAGCAAA
GACTGGGGTGCCAATCCAGAGTTCACGAAGCTCAACCCCCTACTTCATGCCTGGCCCAGCGAGCTGCCAGGCGACATGGC
GCTGTCGTTCCCGTCAGACGGCTCACCACCTTGGCTGCCTTCGTGCTTTGTTGGCAACGTGCACTCATACTACTACCTCA
GCAGTTTACTACTTCACAGGCCGCAGCTGCAAGTGCTCGACCCGTCGTCTCCCGATGGGCGCTGGAAGCACCACATGATG
GTCTGTTACTCGTCAGCGAAGCTTCTGTGTCGGTTGGAAGAAGCTATTCTGCAGACATTCGGCCTGGACGGTCTTCGGAA
CATGCAACGCGGGGTCAACTTCACTATATATGCAATTTTGACGTGCATTGTGATTCATCTGGTATATATCCGTCTCTTTG
AGCCATTCCCCCCCCCCTTCTTGTGGAATTGATGATACTGACAGGGCAGGTCGCACTGACGTCGCCGGACCCGGATTTCA
ACTCAGATGCACGCGAGTATTTTACACGACACATGCGGGTTCTAGAGCAATGTATGAGTGCTTGGCCCATGCCGGAAATG
CAGAAACAGGTCGACTCGATGCGCATGGCTTTCTCGGCCGATACTCGGAAGCCTTTTGTGCTGAAGCAAACGTTCCCATA
TGGAAGTCCGTCACCAGCGTCAAAACATGCCACACCACCGCATCAACAAGCTACCATAAGTGCCGTGGCGACCCCCGCTA
CCATGAACTACAGGCCAGAGCACCCACAAAGCCAATGTGTGGACCAAATCATCCAGCAGCAGCAGCAGCAACAACAACAA
CAACATCTTCAGCAGCAGCATCAGCATCAGCAACATCAGCAACATCAGCAACATCATCAACAGCATCATCTGCAGCGAAT
TGATACATCTCTTTCACAGTGCCTCCCGCCGACAGGCTACATGGGAAATGCCATATCGCCCCCAATATCGGCATCCGCAA
CCGACGTCAAGGGTCTAGTGACGCCTCTGTCTGGTCAATCACTGGCTATGATGGCGTCGGCAGCAGAAGGATCTGGATTA
CCGGATACGCTCTCCAGTCTGGCGCCTGGATGGAATCCGTCTAGAATTTTTGAGTGAGTTTTGCCTGGCTCGTGGCGGCT
GCGAAAGCTGCTGAGAAGATCGCTGACAGTGTTTGTTACAGTCAGTGGAATTCGACATTTGGTACGCAACAATCTACTCA
GCTCAGTTCCGCTACCTCGCAGGCCAGTACTCTAAGTGTCCCTTCGTCTTCAGGTTCCGTCGAGATCCCGACTCTCCAGG
ACATCCAAACCGTGCATGCTAGCCTTCCCCATGAGCTGCACCCCGTACAGGGTTCTGCAACATACGCTGCACCCATCCAA
GCACAACATACATTTGTCACCCCGGCCATGTGGCAAGAATCCGTGGCCAGTGTGTACGAAGGGGGCATCAAGCGTTCCTG
GGATTATGCCAGTGACTCGATGCCGATGTTGAAACGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62