GenePrediction:GLEAN_6543 Details

Name: GLEAN_6543
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_168:180420..179163 (- strand)
Length: 1258
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_168:180420..180096 (- strand)
Length: 325
Type: CDS
Source: GLEAN
Position: GCSC_168:179965..179163 (- strand)
Length: 803
>GLEAN_6543 class=GenePrediction position=GCSC_168:180420..179163 (- strand)
ATGCATCGCCACCTCCCCCTGGCCCTCCTGGCTGCCGTCGCCGCCGTCGTGGCAGCCCCGACGCTGACGTCCGCACCCAC
GGCCACGGCCACCAACGCCTGGATCTCCGTCGGCAGCGACGGCTCTGCCCATACCATCACGGCCGAGCCGACGTCGACAG
ACTCGCACGCAGAAGGGACCGGCAGCACCACCAACACCCTGCCCGAGGCCACGGCCACCAACGGCGCCGGCGCCTTTCCC
GTCTGCCAGAACACCGCCGGCGCACAGGCGCCGTTCTGTGCTCCTTCGGACGGCAGCACGCTCAACCCGGGCGGGACATA
CTACAGTAAGTGGTACGGCAAGACGGAGAGAGATTAGCAAGATCTTTGCTTTCTCCCTTTTGTCCATTTTCTCCCTTCCT
ATCTTCCTCCCTTTCCTCTTTCTCCCCCCCATATCTCTCCCTCGCTCACAACCAGTCACTTGGGATCCGACCTACTTCGC
CTCCACGCCAAACACATCCGTCGTCATCACCGGAAACCTCTTCAACGCCTCGACCGGCGCAATTGTCCAGCAGGCCTTTT
CCTCCGGAACGCTCGCCGCCGGCTGGTCCTTTTATGCCTGGTCCGTCGACGCATCCCTGCTCAAGGGTGCCGGCTCTGCT
GGTGTCAACGTCAGCCTGTCCATGGTCTACCTGACCGGCAGCAGCAGCCAGGCTAACACGTCCGCGTCTGTGTCCTCGTC
CCAATCCGCCGTTGTCCAGGGCCCCGTCGTCACCGTGGCCAAGCCATCTGCCGCCCTCCCTGAGCTCACCAAGGCGCCCA
CCGGCCCAGCCCTGTACATTGGCCTTCCCGCCGTGTTCGGCTTCATCATCGTCGTGCTGGCCGGTACCTTTCTCTGGAAC
CGCCATCATCGCCACATCGGTCTCGGCAACGTCATGAGCCGCTCGCGCTTTGGACCACTGGGCAGCCGCAGCGGTTACGG
CATCCGCAAGTCGCGGCGCCAACGTGCTGCCGTCGGCGCCATCAACCTCGACAGCAAAGATACTGTCGACCTCGGGAATC
GCTTCCACGGCCGCGTCGATAGTGGCAGCGGCAGCACGTCCCACCGGCCGGCCGACCGACTGCGCCGTGACAGCGACCTC
CTCGGCAGCCTGGCCGGCACGCCGACCGAAGATCGCTTCAACGACGACGTCTACCACCCAAACACTACTCACACCGGCAG
CTCCACCACCGGAAACGCCTTCCGCGATGAGCTGGCTAGACAGCAGCGGTCCGGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62