GenePrediction:GLEAN_6544 Details

Name: GLEAN_6544
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_168:168017..166603 (- strand)
Length: 1415
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_168:168017..167953 (- strand)
Length: 65
Type: CDS
Source: GLEAN
Position: GCSC_168:167867..167818 (- strand)
Length: 50
Type: CDS
Source: GLEAN
Position: GCSC_168:167759..167684 (- strand)
Length: 76
Type: CDS
Source: GLEAN
Position: GCSC_168:167614..166603 (- strand)
Length: 1012
>GLEAN_6544 class=GenePrediction position=GCSC_168:168017..166603 (- strand)
ATGGCCAACCTACCACCCGTCTATATCGTCTCTGTCGCCAGAACGCCTGTCGGATCATTTCTAGGGTGAGTTGCACATGG
TTCCTGGAAAAGGGGAGAGCTTCGTCTGTACAGGAGCTGACTGAACGTGTGTTCGTTTCCCATTGTGCAGCTCTCTCTCA
AGCCTCAGCGCCATTGACCTCGGCGCCCACGCCATCAAGTGTACGCTTCAGCAAGAGCTCTGCCCCTTCTGACCCTTACC
TTATACTGACTGCTTCAGCCGCCGTTGAGCGTGTGCCACAGATCAAGCCAGAAGATGTCGAGGAGGTCTTTTTCGGCAAC
GTGCTGTCAGCCAAGTAAGCAATCCTGCGATCTCGGTCTTGTGTTGCACCGGACACGTGAGCTGACATGATATTCTTTTC
CAGTCTTGGCCAGGCGCCTGCGCGTCAGTGCGCCCTGAATGGCGGGCTCTCCAAGAGCGTGATTGCAACCACGGTCAACA
AGGTGTGCGCTTCCGGCCTCAAGGCGATCATTCTGGGAGCTCAGACGATCATGACGGGCAATGCGTCGATTGTGGTGGCT
GGTGGCACCGAGTCCATGTCCAACACGCCGCACTACCTGCCGACGCTGCGCAAGGGCTCCAAATACGGCAACGCAACGTT
GGTGGACGGCGTGCTGAACGACGGCCTGACGGATGCCTACGGTGCCAAGGAGCACATGGGGCTGCAGGGCGAGCTGTGCA
GCGACGACCACAGCATCTCGCGTGCCGAGCAGGACGAGTACGCCATCGGGACGTACCAGCGTGCGCAGGCGGCAACGGAG
GCCGGCGTGTTTGCGTCGGAGATTGCGCCCATTGACGTTCCGGGTCCGCGGGGGAAGCCGGCGACGCGTGTGGACCGTGA
CGAGGAGGCCAAGAACCTCAACATTGACAAGCTGCGGTCGGTGCGGCCGGCTTTCAAGCCGAACGGTGGCACAGTGACGG
CGGCTAATGCGGCGCCTATCAACGACGGCGCGGCTGCCGTGGTGCTGGTGTCGGAGGCGAAGCTCAAGGAGCTCGGGCTG
AAGCCGCTGGCCAAGATCCTTGGTTGGGGTGATGCGGCCCAAGAGCCCGAGCGATTTACCACGGCGCCGGCCCTTGCCAT
TCCCAAGGCCATTGCCCATGCCGGATTGACGGCCGCCGATGTGGATTACTACGAGATCAACGAGGCATTTTCAGTTGTGG
CCCTGGCCAACGCCAAGATTCTGGGCCTGGACGTCGACAAGGTGAACGTGTTTGGCGGTGCCGTGGCCATTGGCCATCCG
CTCGGCTGCTCGGGTGCACGCATCGTCGCCACCTTGACGACGGTCCTGCGTGAGAAGAAGGGCAAGATCGGCGTGGCGGC
CATCTGCAACGGCGGCGGTGGCGCGTCGTCGCTGGTGATTGAGAACCTGCAGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62