GenePrediction:GLEAN_6545 Details

Name: GLEAN_6545
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_168:157155..155008 (- strand)
Length: 2148
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_168:157155..157122 (- strand)
Length: 34
Type: CDS
Source: GLEAN
Position: GCSC_168:157039..156971 (- strand)
Length: 69
Type: CDS
Source: GLEAN
Position: GCSC_168:156912..156675 (- strand)
Length: 238
Type: CDS
Source: GLEAN
Position: GCSC_168:156613..155008 (- strand)
Length: 1606
>GLEAN_6545 class=GenePrediction position=GCSC_168:157155..155008 (- strand)
ATGGCTCCCAGAGTTATTGTCGTCGGCGGTGGCCGTAAGTCAGACCCTGTTGTCACATGTTATTTCACATCGCGAGTCTC
TCTCCCAGAGTAAACAATCACTGACCTCATCCACAGTGTCTGGCCTCAGTGCCGCCCACACCGTCTACCTTGCCGGTGGC
AATGTTGTCGTGGTCGACAAGCAGAGTAAGAATCCCGGCGAGCTTCTGTCTCTTCGTTTTGCTAACCTGCCGGCCGTTCA
CAGGCTTCTTTGGCGGCAACTCCACAAAGGCCACCTCTGGCATCAACGGCGCCCTGACTCGTACTCAGGTCGAGTTGAAC
ATCAACGACAGCGTCAAGCAGTTCTACGATGACACCCTGAAGTCGGCGCGCGACAAGGCCCGGCCCGATCTCATCCGAGT
TCTGACCTACAACTCCGCCGCTGCTGTCGAGTGGCTTCAGGATGTGTTCAACCTAGACTTGACCCTGGTCTCTCGGTTGG
GGTGCGTATTCCCGTTTTTCCTTTTCCTCTACTCCCAAAGGCCCCGCTAACAATGCCTGAAGCGGCCACTCTCAGCCTCG
CACACACCGTGGCCACGACGCAAAATTCCCCGGCATGGCCATCACATATGCGCTGATGCAGCGTCTAGAGGAGCTGGCCG
AGGCCGAGCCAGAGCGCGTGCAGATCATCAAGAAGGCTCGCGTCACCAGCCTCAACAAGGAGGGCAACTTGGTCACGGGT
GTCACATACGAGGCGAATGGCGAGTCCGCCACGCTCGACGGCCCCGTTGTCCTGGCTACGGGCGGCTATGCGGCCGATTT
CACCGAGACGTCGCTGATCAAGAAGTATCGCCCGGACACATACGACCTGGCCACGACAAACGGCGCACACGCCACGGGTG
ACGGTCAGAAGATGGTTATGGCCATTGGCGGCAACGGCATCGACCTGGAAAAGGTTCAGGTACACCCGACCGGCCTGGTC
GACCCCAAGGACCCAGGTGCCAAGACCAAGTTCCTGGCGGCTGAGGCGCTGCGTGGAGAGGGTGGCCTGCTGCTAAACGG
CGATGGCGACCGGTTCTGTGACGAGCTCGGCCACCGCGACTACGTGTCGGGCATGATGTGGAAGGAGAAGGACAATGGCA
AGTTTCCTATCCGGCTCATCCTCAACTCCAAGGCCTCGAATGTGCTCGACTTCCACACCCGCCACTACTCCGGCCGCGGC
CTCATGCGCAAGATGACCGGTAAGGAGCTGGCCAAGGACATTGGCTGCACGCCCGAGCATCTGCAGAAGACCTTTACCAC
CTACAACGCCATCGCCGACGGGAAGCAGAAGGACCCCTGGGGCAAGAAGTTCTTCCACAATGGCCCGCTCGATGTCAACG
ACGACTTCCACGTCGCTCTGATGGAGCCCGTGTTGCACTTCACGATGGGCGGTGTCGAGATTGACCAGCACTCCCAGGTT
CTCAACCAGGAGCACAAGCCGTTCGAGGGCCTCTTCGCATGCGGTGAGCTGGCCGGTGGTGTCCACGGCGCCAATCGTCT
GGGCGGCTCCTCGCTGCTCGGTTGTGTCGTCTACGGCCGCGTTGCCGGCGACTCTGCCAGCAACTTCCTTTTCCAAAACG
TGCTGAAGAGCGCCGGCAGCGGTGTTGGTGGCACTGCTTCCCAGCGTCTCGGCCAGATCTCCCTGCATATCGACCCGTCG
CAGCCCGGCAAGATCTCGGTGGAATGGGGCTCTGCCAAGAAGGGCTCAAACGATGATGACGAGGGCTCTGGCTCCGGCGG
TGCCGGTGGCTCTGGAAGTGTAGGCGGCCCTAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCTCTGGTGCAGGCA
GCAGTACGGCCGCGGCAGCCAAGGCAGGCCCCAAGGTCTTCTCGATACCGGAGAAGGAGTTCAGCTTGGAGGAGATTGCG
AAGCACAACAAGAAGGAGGACCTGTGGGTGGTGGTTAAGGGTGTTGTGCTAGACCTGACCAACTGGCTGGACGAGCACCC
GGGCGGCCCGCAGGCCATTATGAACTTTATGGGTCGTGATGCGTCCGAGGAGTTTGAGATGCTGCACGACGACGAGGTCA
TTCCAAAATACGCACCAGACCAGGTGATCGGCCGGGTACAGGGCGTGGAGCCGACCCTGGAGATCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62