GenePrediction:GLEAN_6546 Details

Name: GLEAN_6546
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_168:140898..139442 (- strand)
Length: 1457
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_168:140898..139643 (- strand)
Length: 1256
Type: CDS
Source: GLEAN
Position: GCSC_168:139583..139442 (- strand)
Length: 142
>GLEAN_6546 class=GenePrediction position=GCSC_168:140898..139442 (- strand)
ATGGATTTCAACAGCTCGTCGCCGTACCCGGAAGGGGTCATCTCCTTCCTGGACACGGACCTGTACAAGCTGACGATGCA
ATGCGCCGTGCTCAAGTACTACAAGGACGTGCCGGTGACGTACTCGTTTACCAATCGGACGCCGGAGAAGAAGCTTTCGC
GGACGGCCTTCCGCTGGCTGAGCGAGCAGATCAACAAGCTCGGCAACATCTCGCTGCAGGACGAGGAACAGGCCTTTCTG
CGCACGCACTGCCCTTACCTCAACGACGCGTACCTGGACTTTCTCAAGGAATTCCGGCTGAATCCGCGCGAGCAGGTCAC
CGTCACCTTTCAGCCGGTGGCCGCTCCAGGCACCGACTCAGGCTTCCCGGCCGAAGAGCTGGGCGACGTGCACATTGCCA
TCCACGGTTCCTGGGTCGACACGATCCTGTACGAGATCCCCATTCTAGCCCTGACATCCGAGGCCTACTTCAAGTTCATG
GACACGGACTGGACGTACGACGGCCAAGAGGACCTGGCGCGCGACAAGGGCATGCGCTTCCTCGAAGCCGGCTGCATCCT
GTCCGAGTTTGGCACTCGGCGCCGCCGCGACTACCACACACAGGCCCTCGTCTTCCGCGGCCTCGTGCAAGCGAGCAAGG
CCGCTGTCGCTGCCGGTCTGCCCGGCCAGCTGTCCGGCACGAGCAACGTGCACCTGGCCATGCGCTTCAACATCCCGCCC
ATCGGCACGGTAGCCCATGAGTGGTTCATGGGCATCGCCGCCCTCCTGGGCGACTACACTCGCGCGACCGAAGAGGCACT
CGCCCGCTGGGTCGGCTGCTTCGGCGAGGGCGTGCTGGGCATCGCCCTGACCGACACCTTTGGCACGCCCGACTTTTTGC
GCGTCTTTGGCCGGCCGGTGCGTGCACCGACGACGACGACTTCAGCTCAGTCCACACCCCGCACATATGCGGAGGTCTTC
ACCGGCGTCCGGCAGGACTCGGGCGACCCGGCCGTGTACGTCAAGACGATGCGGGCATTCTACGACCAGCAGGGCATCAC
GGCCAAGAAGGTCATCGTCTTCTCCGACTCACTCAACATCGAGACCTCGCTGGCATACAAGAAGGTGGCCGAGGCATCCG
GCTTCCAGCCTACCTTTGGCGTGGGCACGTTCCTGACAAACGACTTTGTCAACGTCAAGACGGGCCAAAAGTCCACGCCC
ATGAACATTGTCATCAAGCTGAGCTCGGCCAACGGCCGGCCAGCCGTCAAGATTAGGTGTGTCTGTGCTCGTGGCCTTGT
CTCTTTTCGCTGCCTTCCCTCCGCTAACAAGACAGCGACAATGCCGGCAAAAACACGGGCGACAAGGCGACGGTCGAGCG
AGTTAAGCGCGAGCTCGGCTACGTCGAGAAGGACTGGGTCGGCGGCGACGAGACCCATCGATGGGGAAGAGAAAGCGACA
AGGTCCAGACGGTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62