GenePrediction:GLEAN_6547 Details

Name: GLEAN_6547
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_168:138264..136377 (- strand)
Length: 1888
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_168:138264..138048 (- strand)
Length: 217
Type: CDS
Source: GLEAN
Position: GCSC_168:137982..137900 (- strand)
Length: 83
Type: CDS
Source: GLEAN
Position: GCSC_168:137625..136635 (- strand)
Length: 991
Type: CDS
Source: GLEAN
Position: GCSC_168:136579..136377 (- strand)
Length: 203
>GLEAN_6547 class=GenePrediction position=GCSC_168:138264..136377 (- strand)
ATGGAAAACGCAGATGTCCTGGAGAAGAAGCCGGTGCCTGAGCGGCCAGGCGACTCGGAAGAGGAGGTGGCCGTGGTGCA
GGACGGCACCGTGGTCAATGCTGCCGGGTACAAGGACCAGCTGCAGCGGCAGTACGGCCTCATAGGGCTGGCGGGTATTG
CGCTGACAGTGGACAACGCCTGGGTGGCGCTTGGGTCGTCCATCTCGGTGTCGATATGTGAGTGCTGTGATGTTGGTGAT
GTTGATGTTGTTGGTGATATTTTTTCTGATCTGACTTGTTAGTGAACGGTGGTCCTGCCGGTCTTCTCTACGGCCTCATC
GTGGCCATCTTTTATTATTCATTTATCGGGTTGGGCCTGGCCGAGGTGTGTTTCGTGTTCTCTCTCCTCTCGCCTCACTC
TCTTCTCCTCACTCTCCTCTCTCCTCTCTCCTCTATCTCCTCTCCTCTGTCCTCCTTCTCTCCCGTTCTCCCTCTCCCTC
TCTAACCATCACCAGCTCGCTTCCTCTGTCCCTACCTCTGGCGGCGTCTACCACTGGGCCACACTCGCCGGTGGTCCCCG
CTGGGGCCGCGTTCTCGGCTTCTACACCGGCTGGATCAACTTTTACGGCTGGATGTTCGACCTTGCCTCGCTGCTGCAGA
TCACAGCCAACATCTCCGTCAGCATGTACGCCGTCTACCACGAGGACAGCTTCACCTCCCAGCCGTGGCAGATCTACGTG
GCCTACCTGCTGATCCTGCTGCTGGCCGCCGCCCTGGTCATCCTGGCCAACCGGCTGGTGCCCTATACCCAGCATCTCGG
CATGTTCTTTGTCATTGTGGGCGGCCTGGTGACCATCATCGTCGTGGCCGCGATGCCGCACCAGCGCCCGACCAACGCGG
CCGTGTGGAAGCACTTTCACGAGAACAACCTAACCGGCTGGCAGGATGGCGTCGCCTTTCTGCTGGGCGTGCTCAACGGC
GCCTTCACCATCGGCACGCCCGACGCCATCACGCACATGGCCGAAGAGCTACCGCGGCCAAAACGCGATTTGCCGCGTGC
CATCGGCCTGCAGCTCGGCCTCGGCTTCCTCTACGCCTTCTGCTTCGCCATCTGCATATTTTACTCCTTCGCTGACCTGT
CCGTCCTCCAGGACGGCTCCGTCAACTCCTACCCCCTCGCCTCCATCTACCAACTGGCTACTAGTCATGCGGACGGCAGC
CCCAATCTCGGTGCTACTTTTGGCCTCCTCTTCATCGTCTGGGCCTCCTCTATGCTCTGCTGCGTCGGCACCGTCCTCAC
TACTTCGCGCATCTACTGGGCCCTTGCCCGTGATAATGCCGTCCCCCTCTCTGGCCTCTTCGGCCGTGTCAACGAATCCC
TCAGCTGTCCCGTTTACGCTACCCTCTTCGTATCCGTCGTTGCTGCTGGCCTGGGCGCCATTCCCCTCGGCAGCAACACC
GCCTTCCTCGATCTCACCGGCTCCTTCATCATCCTCACCACCGTCAGCTATGCCATCGCTTTTGGCGCCAATGTCTGCTC
TGGCCGCAAGTACTTTCCTCGTGGCCCTTTCCATCTTGGCAGATACGGCACTGCCATCAATATTCTCTCCATCATCTTCA
TCGTCTTCTTCGACATCATGTACTGCTTCCGTACGTTGCCGTCTCTCTTCTCATCCCCCTTGTTAACTCCTGCTGACCTC
TCCAGCTTATGCAATGCCCACTACTGTCAGCGGTATGACCTACAACAGCGTCATCCTTGTTGGTGTCGTCTGTCTGACCA
CCATCTGGTGGTTCGCCCATGCCATCCGCCACTATCCTGGTCCCAAGGTCATGGGTCTGTACATTGGTGATACCGACCAT
ACTGGCCAGCAGGAAAACTTCGTCGCCGACCCTGCAGGAGAAAAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62