GenePrediction:GLEAN_6549 Details

Name: GLEAN_6549
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_168:116999..114325 (- strand)
Length: 2675
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_168:116999..116802 (- strand)
Length: 198
Type: CDS
Source: GLEAN
Position: GCSC_168:115854..115434 (- strand)
Length: 421
Type: CDS
Source: GLEAN
Position: GCSC_168:115356..115201 (- strand)
Length: 156
Type: CDS
Source: GLEAN
Position: GCSC_168:115127..114325 (- strand)
Length: 803
>GLEAN_6549 class=GenePrediction position=GCSC_168:116999..114325 (- strand)
ATGGCCACATCCCCGGCCTCCCGCTCGAAGGCGACGCACAATCCATTGGCTCCCAGCACTGCCAGCGCACAGGCGAATGC
TGCGCTATCAAACAGCATCAAACACCACAGGCGGCCGATGGTCAGCCAGCCCGATGCCGATCGTGCCGCTATGCCCAATG
GGGCACGCTGGCACACGCAGCGTGTTTGGAGAGAACGCGTGAGCACGAAAGCCAAAAGACGTCATTCACATGTCGCCACC
TCTCTTATTGCAGATAAGATTGAATAGGACAGAAGTATCGAGACCTAGGCCGTTCCACGGCCCGCTGCAGCCTCAGCGTC
TTGGAATGATTTTAGGTGCGATCAGGCTGGTACATCGTAGCGTGTCTTCGTATCATGAGATGAGTATGTGGTTCTTTTCA
AACCGGGAGTTTCTCATGCAGTTGCCCTGATGCTGGACTCCGTGGAAACTGGCTGGAAGAGCCGGCAGAGGTGAGGAAGC
AGAAGACCTCCATTCACTCCATAATGGAAGGTTGGAAGACGAGACGGTGACCAACACAACCACACCGACACGTTCTTGGG
TACCTAAGCTGTTTCTTGTCCGACACTAAATTACAAAAGACCCTGGAAGAAACGAGTTGGTGGGTACAGACGGCCCTGGT
CTGCCTTCAGTCCCGTGGCTTTTTTTCGGCGATCGGCAAGTACTACTCGTATCTTACATGGTGTATCGTATCTCACATAC
TACGTCCATATGTAGGGAATGCAAGAGCATATGAAGACTCGATGCAAGGAACGTCTACATGCAGGAATGGCGGCCGCGAC
AGGGTGGTTCTTCCAGTTGCGATATGCAGAGCTGCGCATTAGCAGAGATGAAAGTCCTCTCCCCCTGCGTGTTAACGCCG
TTGATAAGGATGGCAGGATGACAGCGCGGGACCCATCTTGCTGTCGCTTGGGCCTCTTTTCCATTTGCGTCGAAAAGACG
CCGGGTAATGAACGCGTTAATTTGCCTGATCTTCTGCGCATAGAAGGGGTGCTAAGATGCGATGGCAGGCAATCTTGAGA
GCAGAAGATTGGAAGGCACTGTATGCAGTAAGTACTCCGTACTCCGTACTCCGTGCCCGTGTACTCGTACTCGCACACTG
AAGGTGACCGTACGTGCGCGCAGAGTGGTCCGATGGTGGAGAGTCAGCCTTGGCTTTCGGCGAGGACAGCGAAGGAAATG
ACTGCGTGCAGGCCCAAAAGGGAAAGCCAGACAGCGGTCCCCCGTCAGAAGCGGCAATTCGGCCCCATGCCTTTGCGACG
GTGGAGACGCTCCTGAAATGCCCGTACCTGATGGTGCTGGCAGGATTCGATCGGAAGCAGCGACGGCGTGTATTAATAGC
CCGGGACCATGCAGCGCGCTGCGCACTGGTCGACGGGACAAGAGGACAAAAGGGCCTCCTTATTTCGCCTACGACGGTGA
GAGGCGCGCAGGAACCCGGTGCTCGTATCGGCAGGCGAATGGGAGAGATCCAAATGGAGGACCGAAAGGCGACTGGTGGG
ACTCTTCCCCTGACCTACGCCGATTGGCGACTAGTCCACCAGATCAGTAAGATACGAGCAGACCTCTTACGACCTTGCTT
CCCATCTGCCATAGCTGTGAGCGTTCCAGATTATACATAGTAGCCCACACACCGCCCAAGGCCGGTTGGCAACAGATGCA
GCGCAGGTCACAGGAGCGGCCTCGCAGCGACATCCGCACGGCGTGGGTTGACAAAGAAGATTGCGGTGGCCAGACGCAGC
AGATGAAGTTGCATCGAGGCGAGGCGATGGATCGTCCCCGTGACTGCAGCCCGGCCGTTGGGGGCATTCCCCTTGCCTCT
GCATGAGCCGGAAATAGCTGGCCGACGTCCAGCACACGAGAAGTCGTGCAGTGTCCGGGAGACTGCCGGTGTCTCTAGTG
AGGCGCCGTTGGGGCGTGCATATGCCGCAGATGCCGTCTACTGCAAGGGGCACAGAGAGAACGAAAGAACGGTGGCTAGG
CTGTACGTGTCTCTCACCCTGCTCTCGACCCCCTTTCTCATCGCCTGTTTCACTCCAGGTTGCCACAGACGAGGCAAGGA
CGGTCATGATGTTTGTTCTGGTGCGTCGGGCCCCAATCTCCGTCGTCTCAGCCCAGCCAGCTCCAGGAAGGGCGGAGATG
CGATCGACGTTGCTCCACTGCTGCTATCGGGCCTCGCTGGCCTCGCTATCTGCGTGCGTCGTCGTTTGCCGGCTGGACTG
TCTAGTCGTGTGCCAGGCCTGCCGCGAGTCAGCAAAGAGGGTGGGCACGACCGACGAAGCGTTGTGAGAGACAAAGAAGC
CGAGCATAGGCCGAAGGTGGCTAACGGCCGGCCTGACAGCAGCGCGGAGAACGGGTGGAAAGAGTCGGACAAGGTGGTCG
GTGAGGCCTTTGGGACCTGCTGCCCAGCGTGTTTGTGGGTTCCCATCCGGCATCCCGGGCCTGGACAGCTCGAGATGAAC
ACACCGCCGCAGCACAGGCCCTTTGGCTGTTCTGTTGGCTCTCTTGCTTTCCTTTTTCTATTTGGCCTTTGTAAGATTCG
CCAGGTGAAGGTCCAGAAAACGAGGCGATCTGGACGGCCGCTATTACCCCGCAATATTCTGATTGGCCGACACCGGCCAG
ACGAACCGTCTCTCCTGCTGCAACCCCCCTCCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62