GenePrediction:GLEAN_6551 Details

Name: GLEAN_6551
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_168:101402..100173 (- strand)
Length: 1230
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_168:101402..101109 (- strand)
Length: 294
Type: CDS
Source: GLEAN
Position: GCSC_168:100505..100173 (- strand)
Length: 333
>GLEAN_6551 class=GenePrediction position=GCSC_168:101402..100173 (- strand)
ATGATACTGATTGACGTCGCATATGGCGGTGGTACGGCGGCTGTCGCTCGGGTGGTGAGGAAGCCTGTATCTTACAGAAA
AGAGAAGATGGGAAGAGCATGGAAAAGCCGGGTTGCAGCGCTCCCGAAATCGGCTCTGTCCAATGGCTGCACGGCAGCAG
GAGAAAGAGGCCAGACGGGGAGACGGAGGCAACGGATCTCGGGTGGCGGAGAGGTGCAGGAGCACAAAAAGAAGATGAAA
TGCAAGGTCGGGTGGGAGAGAGAGGCGTGGTGGCTTCACAGGCGCCCCAAGAGGGTATGCATGAGGATCAGGAAAAAAAG
AAAGCGAAACGGATGGAAATCGACAGTGGCAAGCGGCTAACGGAGACCCGTTGCAGAGCGTGGGATTACTGGTCAAACGG
TAACCGTTTTGCGACCTAGAACCATTTCTCCCTGGTCTGTGCTCTGCCTGTAATTATTCTACGGAGGAAAGAACGCGGAG
GGCAGGAGCGCTTCTCGGGCATTGTGTAGCGCGCAGATAGGAGCAGGCGAAGGTGCTGTGTATCCGTAATTCAGAGGCGA
GTCCGGCCAAGGTCAGGACACAATGGACAACGGCGCGCTGTCAGCATGCCACAGTGCCTGCGGCCCCTATCGTATACCAG
TAAGATACGAGTAGGACAACGCTACAACGGTCTCTGGCTGCCCACTGTTTCCGAGGCTTGGACGAGCCTCTTGCAAAATG
CTCGGGCGCTGTGGGGCGAACGAGATGAGCACTTGCGACAACAGATCCTAGCTGGCGAGCCTCGGCATCCACTAGGCCTC
ACGTCATCCCCACCCGCAGTGCGACTGATAGGCAGATGGTGTGAGATATGGCCCTGGTGTCCATTATTACCCATACTACG
AACCCTGCTAATTAAAGGCTTCTCGACCGGGTGGAGGGGGCCAAGCGACCATTGGAATGGCAGCCCGCCCCGGGTTTCAG
AGACGGAGCGAGAAGACGTCGGGCGACACGGATTCGAGTCCAGCTCATTCTCAAAACGCCTCACCATCTGACGCGTACTC
GTACTCAAGCTCTGGCGTGCCTTTTCGATGCTCGCATCTGACTTTCGACAGCCGGTACTTCCAGACCAGGGATGTCAGTT
CTCTGGCCACCCGGCACAAAGAGCTGCAGGTACCAGCACAGGCCGATGCTGGACAAAGGCGGCTCGAGGGTGGTACCGCT
ACTGCAAGAGGCGAAAGCAACCTTACCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62