GenePrediction:GLEAN_6554 Details

Name: GLEAN_6554
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_168:87662..86130 (- strand)
Length: 1533
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_168:87662..86130 (- strand)
Length: 1533
>GLEAN_6554 class=GenePrediction position=GCSC_168:87662..86130 (- strand)
ATGGCTAGCGCAGGGGATCTGACGAGCGATGTGCTCCACGCGCTCGCCAACACAGACACGATCCTGACGGCCGAGGTGTT
CCCCGCGGTCAAGTCGACCGACATGCGGAGCGCGCTCGACCGGCTCTCGTCGCGGTCCATGGTGACGTACGACACGCTGG
AGCGGGACGAGATCCTGCTGGAGGCTGAGGGCAAGCAGATTGCGGCCAACGGCAGCCACGAGGCGCGGGTGTTTGAGGCT
CTGCGGGCGGCTGTCGAGGGCCTCTCGGTGGCTGAGCTCGAGGCAGCCGTGGGCGACAAGAACGTGGCCAAGCTGGGTCA
GGGAAAGGCGTTCAAGGAGAAGTGGATCAGCCGGACGGCCGAGGGCAAGTTCAAGGCGGTGGCAGCGGCGATCCAGGACC
GGACGCGCGAGCAGCTACAGACGATCGACCAGACCGGCACGCTGGCCGACGCCAAGGTGGTGGCAGAGCTGCGGAAGCGC
AAGCTGGTGCGGCTGCAGAAGGTGACGAGCTTCCGGGTGCACAAGGGCGAGCGGTTTGCGCTGGAGCTGGTCCGGGAGGA
GACCGACCTGACGGCCGAGATGTTGGCCTCGGGCGCCTGGAAGACGGCCGCGTTCAAGCCGTACAACTTTGCGGCACTGG
GCGCAGACCAGAATGCCGGGGCGTTGCATCCGCTCAACAAGGTCCGGCACGAGTTCCGGCAGATCTTTTTTGAGATGGGC
TTCGAGGAGATGGCCACCGACAAGTTTGTCGAGAGCGGGTTCTGGAACTTTGATGCACTCTTTGTGCCGCAGCAGCATCC
AGCCCGCGACCTGCAGGACACGTTCTACATCTCAGATCCGGCCAAGGCTGACCGGCCGCAGGCCACCGGCCCAGATGACC
AGCAGGACTATGCGGCGTACTGGGACAATGTCCGGCAGGTGCACGAGACTGGAAAGTACGATTCGATCGGGTACCGCTAC
CCGTGGGCGGCCGATGAGAGCTTGCGGCTGGTTCTGCGCACGCACACGACGGCCGTGTCGGCGGCCATGCTGCACAAGCT
GGCAGCACAAAAGGGCCCTGACGGACGGCCGCCGCCGGCGCGCTACTTCTCGATCGACCGGGTGTTCCGCAACGAGTCCG
TAGACGCGACCCATCTGGCCGAGTTCCACCAGGTCGAGGGCGTCATTGCCGACTACGGGCTCACGCTCGGCGGGCTGATG
GAGTTTATGGACATTTTCTTTGGCAAGATGGGCCTCGAGGGCATCAAGTACAAGCCGGCATACAACCCGTACACGGAGCC
GAGCATGGAGGTCTTTAGCTACCACAAGGGTCTCAACAAGCTGGTGGAGATTGGCAACAGCGGCATGTTCCGGCCGGAGA
TGCTGGAGGCCATGGGGTTGCCCAAGGACATGCGGGTGTACGGCTGGGGGTTGAGTCTGGAGCGGCCGACGATGATCAAG
TACAAGCTCAACAACATCCGGGAGCTGTTGGGGCACAAGACGGATCTGAACTTTATCAAGCGAAACGCGGCCGTGCGTCT
GGACAAGGATTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62