GenePrediction:GLEAN_6555 Details

Name: GLEAN_6555
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_168:85597..81973 (- strand)
Length: 3625
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_168:85597..82139 (- strand)
Length: 3459
Type: CDS
Source: GLEAN
Position: GCSC_168:82080..81973 (- strand)
Length: 108
>GLEAN_6555 class=GenePrediction position=GCSC_168:85597..81973 (- strand)
ATGATGTCGGCCGTGTCCCTGGCGGGCCGGGCTCCGTCTTGCCTGCTCCGGCATGGGCCAACCATGCGAATGGCAGGGCA
GGTTCCGCGGTCGGTCCGGGCGTTTTCGACGGGCGTGCTCCAGAGCAGGCGGACACCGTCTATGGCGCCGCAGCTGCAAA
GCCTGTGCTCGCAGCGGACGCTGACGCAGTCGACGCGGCGGGCAGCTGCATCAGCAGCCGGCGTGGGCGGCCAGTCGGTG
CACAACCCGCGGGCGTACCTAGAGAGCGGCGTGATCAAGCCGCGGGAGCACGTGGACGTGAAGAAGGTGCTGGTGATTGG
CAGCGGCGGACTGGCGATCGGACAGGCTGGCGAGTTTGATTACTCGGGATCACAGGCACTCAAGGCACTCAAGGAGGCTG
GCGTGGCGTCGGTGCTGATCAACCCGAACATTGCGACGATCCAGACAAGCCACACGCTGGCAGACGAGGTGTACTACCTG
CCGGTGACGCCCGAGTACGTGACCTACGTGATCGAGCGAGAGCGGCCAGACGGCATCTTCCTCTCCTTTGGCGGGCAGAC
GGCACTGAATCTGGGCGTGGAGATGCAGCGCCAAGGCCTGTTTGAAAAGTACGGGGTGCGGGTGCTGGGAACGAGCGTGC
GCACGCTGGAGCTGAGCGAAGACCGCGACCTGTTTGCGCGAGCGCTGGACGAGATCAACATCCCGATCGCGCAATCGACG
GCCGTCGGGACGGTGGACGAGGCACTGGCCGCGGCCAAGACGGTCGGCTACCCGATCATCGTGCGGGCAGCATACGCGCT
CGGTGGGCTGGGATCGGGCTTTGCCAACGACGAGGCCGAGCTGCGCGACCTGGCAGCGCGATCGTTGACGCTGTCGCCGC
AGATCCTGGTGGAAAAATCGCTCAAGGGCTGGAAGGAGGTCGAGTACGAGGTGGTGCGCGATGCGAGCAACAACTGCATC
ACGGTGTGCAACATGGAGAACTTTGATCCGCTGGGCATCCACACGGGCGACTCGATCGTCGTGGCGCCGAGCCAGACGCT
CAGCGATGAGGAGTACCACATGTTGCGCACGGCTGCTATCAAGATCGTCCGTCATCTCGGTGTTGTCGGCGAGTGCAACG
TGCAGTATGCCCTGCAGCCTGACGGCCTGGACTACCGCGTCATCGAGGTCAACGCCCGGCTCTCGCGCTCGTCTGCCCTG
GCCAGCAAGGCTACTGGTTATCCGCTCGCCTATACGGCCGCCAAGATCGGACTGGGCCACAGCCTGCCGGAGCTGCCCAA
CGCCGTGACCAAGACGACGACGGCCAACTTTGAGCCCTCGCTCGACTACATCGTCACCAAGATTCCGCGCTGGGATCTGG
CCAAGTTCCAGCATGTGCGCCGCGACATTGGCAGCGCCATGAAGAGCGTCGGCGAGGTCATGGCCATCGGTCGTACCTTT
GAGGAGTCTTTCCAAAAGGCCGTCCGCATGGTCGATCCGCAGTTTGTCGGCTTTCAGGGCGACGCTGACTTTGCCGGCAG
CGAGGCCGTGCTCGACGCCGAGCTGCAGAAGCCGACCGACCGTCGCTGGCTCGCCGTCGGCCAGGCCATGCTTCACGAAG
GCTACACCGTCGATCGCCTACACGACCTCACCAAGATCGACAAGTGGTTCCTCTACAAGCTGCGCAACATTGTCGACTGC
ACCCGCGAGCTGCAGGCCGTCGGCAGCCTGCACGGCCTGAAGCGCGATCTCGTCCTCAAGGCTAAGAAGATGGGCTTCTC
CGATCGCCAGATCGCCGCCGCCGTCGGCAGCAACGAGGACGCCGTCCGTGCTCAGCGCCTGCAGTTCGGCATCCGCCCTT
GGGTCAAGAAGATTGATACCCTTGCTGCCGAGTTTCCTGCCGACACCAACTACCTCTACACTACCTACAACGGCAGCACC
CACGACGTCGACTTTACCGACAACGGCAAGATCGTCCTCGGCAGCGGCGTATACCGTATTGGCAGTTCCGTCGAGTTCGA
TTGGTGTGCTGTCAGCGCAGCCCAGGCACTGCGTGACCTAGGCGAGAAGACGGTGATGATCAATTTCAACCCGGAGACGA
TGAGCACGGATAGTGACGTTGTCGACCGGCTTTACTTTGAGGAGCTCAGCTACGAGCGCGTAATGGACATCTACGACCTA
GAAACGGCCTCGGGCGTGGTGGTGTCAGTTGGCGGCCAATTGCCACAGAACATTGCGCTACGGCTACAGGAGACCGGTGG
CGCCAAGGTACTAGGGACGGACCCACGTGACATTGACCGTGCGGAAGACCGGCAAAAGTTCTCGGAGATCCTCGACAGCA
TCGGGGTGGACCAGCCGGCCTGGAAGGAGCTGACATCGGTGGCAGAAGCGGCAGCATTTGCCGAGGCAGTCGGCTACCCA
GTGCTGGTGCGGCCCAGCTACGTGCTCTCGGGCGCGGCGATGACGGTGATCCGCAGCGCGGCCGACCTGCAGCACAAGCT
GGAGGCAGCAGCGAGCGTCTCGCCCGACCACCCGGTCGTCATCAGCAAGTTTATCGAGGGGGCACGCGAGATCGACGTGG
ATGCCGTGGCCAACGGTGGCCAGGTGCTGGTGCATGCTGTCAGCGAACACGTCGAGCAGGCGGGCGTGCACTCGGGCGAC
GCCACGCTGGTGCTGCCGCCAGCTGCCCTGGACGACACCACGCTGGCACGCGTGCGCGAGATCGCCGACAAGGTCGCACA
TGCTCTGCGCATCACCGGCCCTTTCAACATGCAGATCATCCAGGCGGCTGATCCGGAGGGCGGCCTCCCGGCGCTCAAGG
TGATTGAGTGCAATCTGCGGGCATCGCGCTCGTTTCCCTTTGTCAGCAAGGTCCTCGGCACCAACTTTATCGACCTGGCC
ACGCGCACGCTCGTCGGCCGTGACGTCCCGCCACCGACTGACCTCATGCGCGGTCCCGTCGCTGATGCCCGCGACTATCT
CGCCATCAAGGTCCCCCAGTTCTCGTGGACTCGGCTCGCCGGTGCCGATCCCTTCCTCGGCGTTGAGATGGCCAGCACGG
GCGAGATGGCCTGCTTCGGTCGCGACCTCGTCGAAGCGTACTGGACTGCCATCCAGTCCGCCATGAACTTCCGCGTTCCC
GAACCAGGCGAGGGCCTCCTCTTTGGCGGCGAGACCGATCCCGACCGCGACTGGCTCGCGCAGGTCGTCCGCTATGTCGC
CCCCCTCGGCTACAAGCTCTTTGCTGCTGAGCCCGCCGTCAAGACCTTTATCGAATCTACCGCCGCACAGCCCGTCGACG
TCCGCCTGATCGAGTTTCCCAAGGACGACAAGCGCGCCCTTCGCGAGGTCTTTGCCAAGTACGACATCCGCGGCGTCTTC
AACCTCGCCCGTGCCCGCGCCGAGACCACCGGCGACGTCGACTACGTCATGCGCCGCAATGCCGTCGATTTTGGCGTTCC
CCTCTTCATGGAGCCGCAGGTGAGTACTACAGTGGCGTCGGAATTACGGGGAAAATCATTATATGCTGACTACGCAGACC
GCCATCCTCTTCGCCCGCTGTCTTAGCGAGAAGCTGCCTCGTCCAGCCGGCATCCCGTCCGAGGTCCGCAGCTGGTCTGA
TTTCCTTGGTGGAAAGCCCTTGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62