GenePrediction:GLEAN_6556 Details

Name: GLEAN_6556
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_168:78501..77636 (- strand)
Length: 866
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_168:78501..78396 (- strand)
Length: 106
Type: CDS
Source: GLEAN
Position: GCSC_168:78333..77636 (- strand)
Length: 698
>GLEAN_6556 class=GenePrediction position=GCSC_168:78501..77636 (- strand)
ATGATTGACGTGGACTGGAGGGGGCTCATCCTCCCGGTCTCCTACCTGCTGGTGCTCGGCGGCACCTTTGTCACCTTCTC
TACGGTGTACCGGAAACGGAAAGCAGGTGCGTACTGCGCCGTCTCTCGTTTTCATTGCCAGTGGACCTGCTGACCATGTG
TCCTACAGCCCAAAGCGCGAACCTGAGCCCTTGGTTCCCGCCGCACCTTCAGCGCAACATCTACCTCTCGCTCCTGCACA
TGGAGCCGGCGGCCGGCGGGGCGGAGAAGAAGACGCCCAGGGTGCCGGACTCGGTGGTGCGGGCCGCGCTGCTCCGGCGA
GCGGTCGAGGACATCCGGCGCATCATCCAAATCCGCACGGGCAAGCAGGCGTGCGGGATGCTGCTGCAGCGCGGCAGCGT
GGGTGACGACCTCTGGCAGCGGTTCCAGCGTGCGGAGCGTGAGATGGAGGAGGAGCTGCGCGACGTCGTCATGGAGGCCA
ACGCGCTGGTGCCCAACTGGGGCCAGATCATCTTCCAGACCGCCAACGCCATTGCCGGCAACGCCCAGCTGCGCGACAAG
CTCGACGCCATCCAGAGCCAGGTGGGCGCCGAGAAGGCCTGGTGGGCTCGACGCAAGGCCAGCATCACGGAGGAGCTGCT
GAGCGAGGAGGACAAGGGAAAGGCAGCTACGACGGCAGCGGCGGCGCCGGCGATACCCAAGACGACCGTCCCAGCTTCCA
TAGCGTCCAGACCAACTACCTCCTCTTCGAGACCATCCACGCCGGCCACAGGCAAGACCGACGACGACGGCGTGCTCGTG
GATGTCGGCACGCCCGGCAGCACGGCTTCGACGGGTGGCGGCAAGAAGAAGAAGGGCAAGAAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62