GenePrediction:GLEAN_6558 Details

Name: GLEAN_6558
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_168:57660..55946 (- strand)
Length: 1715
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_168:57660..57628 (- strand)
Length: 33
Type: CDS
Source: GLEAN
Position: GCSC_168:57546..57513 (- strand)
Length: 34
Type: CDS
Source: GLEAN
Position: GCSC_168:57455..57361 (- strand)
Length: 95
Type: CDS
Source: GLEAN
Position: GCSC_168:57304..57283 (- strand)
Length: 22
Type: CDS
Source: GLEAN
Position: GCSC_168:57230..57179 (- strand)
Length: 52
Type: CDS
Source: GLEAN
Position: GCSC_168:57074..57063 (- strand)
Length: 12
Type: CDS
Source: GLEAN
Position: GCSC_168:56996..55946 (- strand)
Length: 1051
>GLEAN_6558 class=GenePrediction position=GCSC_168:57660..55946 (- strand)
ATGGCTGACCAATCTATCATACGGATCACCAAGGTGCGCTCTGGCTCCAGCAATTTGCCTCGGGCAGTAATCCAGAGTCT
CGCCACGTGCCAGATACTAACCGCCCCTGTGCAGGAACTGAGCGACATCCAGAAGAACTCCGATTTCTGTTCGTGAACGG
CTCCTGCTCCTGCTTATCTTTTTACTCTTGGCTGACATCAACCAGCGCTTGCCGTCGCATGTCGCGATACCGATGTCCGA
AACGTCACGGCCCTGATTATTGGTCCCCCGGAAAGCCCATACGAGTTTGGTTTTTTTGAGGTGAGAGGATCTCCGGCCGA
CTTGTGGTGTGTAATTTCAGATACTGACGATCTCAGTTTTGTCTCAAGTTCAGCAAAGGTTTGCTCCTCCGCACGCTTGT
CCGATAACAGCGTCTTCTGACCTCCACCAGAATACCCGCGCAAGGCGCCTTCCGTCACGGCGATCACGACCAACGGTGGT
CGGTGTCGGTTTAACCCAAATATATATTCTAACGGAAAAGTTTGCTTGTGAGCGTCTCTTGTCCCTCTGCTTTTGCCTTT
TGTGGCTAACGATCTATGACCATCAGGTCTATTCTTGGGTATGTCTAGCACGAGCACGCGGATACTATTAATACGTTTCG
ACGACGGGTAAGCTGACAAAGTAGAACATGGCGCGGCGAGCGAGGCGAAGAGTGGTCGGCTGCCCAGGGCCTTGAATCGA
TCCTGCTATCGATCCAAAGCTTGATGTCCCCCAACCCGTACGAAAACGAGCCGGGCTTTGAGGAGGCAAACGAGGAATCG
GACAAGAAGAACCAAAAAGAATACGTCCAAAAGATCCGACACGAATCGCTTCGGATTTCTGTCATTCAGCGTATGGAGGA
GTTTCTGGGCATCGGCACCATCGGCTACGGCAGCCGAACGTCAGACGCTTTTTCTCGGCCAGCGTATCCAGCTATCGACA
TGGAAGGGCTTGACGATGCTGCGGTGCCGTTCGAGCCATTCAAGGACCTCTGCAAGCGGCGGTTTCTGTGGTACTTTGAC
TCGTACATGAATGCGGTACAGAAGGGCAAGGATGAGGTTCCCGACAACCAGCCGTTTGTACGCATGCCATTTGAAGGAAT
TAGCAACATCATGGAAGGCAAGTTTAACTACACAGATCTAGAGTGGCGGCTCAACGCAGTGAAGACGGCGCTGGACGACG
AGACGACGCAATGGGCGGCGACAGGCAAAACTGCGCAAGACCAGGATGCCACAGTGGCAGTGAATTTGCAGCGGCAGTTT
GAACAGGTGGTGGAGGCGTTCAAGCGCCACGGAATACCGCACAATATTGAGCTGGAGGACGGCAACCCATTTGTCTGGAT
GGTGACGTATTTTGGCAAGCCGATGACGAACCTGGACGGCGGCCTGTTCCGGTTCCGACTGCACATGAGCCCACGGTTCC
CGGAGGAGCAGCCACGGGCGCGGTTCGAAACCCGCATTTTTCACCATCGCATAGCGGCAGACGGTACGCCGTGCTATGTG
GTGACACCGAACCGGCGGGAAGACATCAAGTCCCATATTGAGGCGATCATTGACACGCTGGAGGAGGAGAACCCGCGGTA
CGACCCGAGGGCACTTGTGAATCCCGAGGCACACAAGCTTTACTGGGGATCGGCAGAGGACCGCAAACTTTACAACCGGC
GGCTGCGGCGGACAGTGCAGCAATCAGTGGAGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62