GenePrediction:GLEAN_6559 Details

Name: GLEAN_6559
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_168:52066..51527 (- strand)
Length: 540
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_168:52066..51527 (- strand)
Length: 540
>GLEAN_6559 class=GenePrediction position=GCSC_168:52066..51527 (- strand)
ATGCTCTACTTTGCCTTTGGCAGCAATCTCTCGCTGCAACAAATGTCCAAACGCTGTCCGCAGAGCCGCTTCATCGGACG
TGCTATCCTGCCTGACTACCGCTGGCAAATCAACCAGCGTGGATATGCCAATGTCGTACAGTGCTGCGGTAGCTCTGTGC
ACGGCCTGGTATACTTGCTCGAAGCTGCCGACGAGGTTTCTCTTGACCGCAGCGAGGGCGTCGGCATTGGCGCCTACAGC
AAAGACTACTGCGACGTTCTCCTCTATCCAGCCGCTGTCGAACTGCAGAAACAGCCTGACCAGGTCAGAAGTGCTATTGA
TGGCGATCAGCAAGGCGCCCACCCACCCGAGCAGCGACCACATCTGCAGGAGAACACGCTCGTGTATCTCAGCACCCACT
ACATCAAACCTGGTGCTCCCCACGAAGAGTACATCCACCGCATCAACACTGGCATACGAGACGCTGTCTCACTTGGCGTA
CCGCCTGCCTTCTTCGAAAATGCCGTCCGCCCACTGGTGCCTTCTGAGCTTGAAGGTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62