GenePrediction:GLEAN_6561 Details

Name: GLEAN_6561
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_168:40716..38700 (- strand)
Length: 2017
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_168:40716..40508 (- strand)
Length: 209
Type: CDS
Source: GLEAN
Position: GCSC_168:40431..40022 (- strand)
Length: 410
Type: CDS
Source: GLEAN
Position: GCSC_168:39816..39577 (- strand)
Length: 240
Type: CDS
Source: GLEAN
Position: GCSC_168:39519..39285 (- strand)
Length: 235
Type: CDS
Source: GLEAN
Position: GCSC_168:38925..38700 (- strand)
Length: 226
>GLEAN_6561 class=GenePrediction position=GCSC_168:40716..38700 (- strand)
ATGTCGATAAGGTCTAACTCCAACCAGGCTACAGCAGTGGTCTCCGACAAGGAGGCCAGCAATTTTGTGTCCCACGATGG
CGAGAATCTGGCGGACTGCCCGCGGACGATGGCGGACCTTGGGGTCAACGAGAAGCAGCTCGTTCGCAAGATGGACTGGG
CCCTAATTCCTTTGGTGATGCTCCTTTATTTGTTTAGCTTTTTGGACCGGTAGGTCTCCAGAAGGATAGACCTGATAGAG
CGTTGAAGACAAAGATCCAAGGTGCTAAAACTCTGTTGCATTTAGTGTCAATATCGGCAATGCCCGCCTGTACAAAATGG
AAGCTGATCTTGACATGCATGGCACTCAATACCAGACGGCCGTGTCTATCTTATTCGTCACGTACCTCACCTTTGAGGTT
CCAAGCAACCTTCTGCTTAAAAAGCTCACGCCGAGCCGCTGGATCGCTTTTATCACAATGACCTGGGGAATTATCGCTAC
CTTGACCGGAATTGTTCAATCTTACGGGGGTTTGATTGCCTGCCGCCTGTTACTAGGCGTCGTTGAAGCCGGATTGTTTC
CCGGTCTTAATGTCTACCTAACTATGTTCTACACACGTCGCGAGATCGCGCTCCGTGTTGGCTTCCTATTCGTATCTGCC
GCTATAGCGGGTGCTGTCGCAGGCCTTCTTGCCTACGGTATTGGGCACCTGGATGGTGTGTCAGGAATGAGCGGATGGCG
AGTATGTGAGGGCCTGTATATTCAAAGTGCTCTAGACGACATGTGGAAAGGTGCATGTATTCTCATGCACTAGAAGCTAG
TGCAGGCTGTACTGCGGGAGTGAAAACTCTGCACACTGACCCACAGGGTCACGTGCAACACGACATCACTGACCGACTAA
AAAGTGGATCTTAATCATAGAAGGCCTGCCTAGTCCTGTCCTGGGCTTTGCCACATATTTCTTGTTGCCAAACGAGCCAG
AGACAGCCTACTTCCTCAATGAGGCCGAGAAGCGTGCAGTCGCGTTACGCTGGGCCAGCGAGTACGGCAATACGAAGAGT
GCCCAAGAGTTCAGCAAGGTCGACATGATGAAGGCTTTTACGGACTGGAAGGTGTGGGTTTTTTGCGCGGGTCAATTTGG
TGCCGACACCATGCTTTATGGTACGTGAGAGATAATGCCTGCTTTGTTCATTGGGGCAAATTCTCACAGCCGTATAGGCT
TTTCTACATTTCTGCCAACCATCATCAAGAGCCTAGGTCACTGGACGACGGCCCAGGTCCAGCTACTAACCATTCCCGTC
TATTTTCTTGGCGCCGCCGCTTATATGACTTCAGCTTTTCTCTCAGACCGTATACAGCGCCGTGGTGTTTTCTGTATCGT
CTTTGGACTTATCAGCGTGGTTGGATACGGTGTGTTAATCTCAGACACGTCGGCAGGCGTGCACTACTTTGGGTATGTAT
TATCTGGTTTCGGCTCTTTCGTTATATTCATTTTATCTCTAATCGTTACCAGGTGCTTCCTTGTAGCTATGGGACTGTAT
GTTGTTGTTGGCATTCCTCTGGCATGGGTAAGATCTTAACATCGTACAATCCCATCATCTGTCTCAAGCCTTGATGCAGT
TAGCTGATGTTAATAGATGCCAAGCCTTTGCCCCCGGTATGGGAAGAGGACGACTGCAAACGGAATGCAGCTGACCATGG
GAAATGCATCTGGAATTATGGCGCCATTTATTTAGTAAGTAAATCCTATGCCACCGTCTTTCATTTGTGCATAATATCAT
CACACTGCTTTGTCTTTTAACCAGCCAACAGCTCATCAGTCGATGCGCCCCGCTTTATACGCGGTCATGCCGTTACCCTA
GCCATGGTTGCCTTCGCCGCTGTCACTTATGGGTTTATGTGGTGGTATCTTGATTTCGTAAATAGGTCAAGAGATGTCAA
GGAGAGAGAGGCAGCAGAACAGGGCTGTCCTTTGCCCCCCCGTGAAGAATCGGAAGACTTAGGCGACGACAGCCCATATT
TTCGCTACATGACATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62