GenePrediction:GLEAN_6572 Details

Name: GLEAN_6572
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:1412401..1410188 (- strand)
Length: 2214
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:1412401..1410653 (- strand)
Length: 1749
Type: CDS
Source: GLEAN
Position: GCSC_156:1410595..1410188 (- strand)
Length: 408
>GLEAN_6572 class=GenePrediction position=GCSC_156:1412401..1410188 (- strand)
ATGGACCACGACCAAGGCTCCGGACCGGGCACCCCGGACGAAGAATGCGACAGCGGCCCGGCTTCGGGCGGCTCCATCGA
CTCTAGAGACGACACGGCTGGTCGTGACCGTCCGAACTGGGGATTCGATCCCGCAGCCTCCTCCCAACACGCCGCAGATT
TGTCACCGTCCCTGTCACAGCCAATGTCTTCGCAGCAGCCGGCAGACTTGCCACAGTCACCGCGGCGCTTGCCCTCTCTT
CGCACCGTCTCCGACCCGCAGACCAGCACTGTCGGCTACATGAGTTCGACCTCGACCGTTAGTGGAACTCTCAACAATGC
TCGACGCCCTCCTCCGTCTGCCGGGAACCTGCCACAGGACTTGATGCAGAAGGCCCGCGCCCTGCAACAGAAGCGCATGG
CTATGTCACCGCACTCTCCAGGTGGCGCTAGTGGCCCACTCTCGGACGCTTCGCATGCCAGCCTTGGGGGTGCTCTGGCC
GGCGGCATCGCTAGCAACATGCGCCTGCCCGCCCATCTTAATAGGAACATGGGGCTTGGCGGCATAGTTCGGCCAGGGCC
GCCTGGATTTCACCAGTCAGCTCCCAGTGTGCCGAGCGCATCCGGCCGGAGAGGTGGGCCGAGTCTTAGTGAGCGCCGAG
CTATGAAACTGGGACCATTACCCGGTGGTCCCGGCGGCGCGTCATCCCAAGGGCCACCAAAGCTGTCGGACATGGACGGT
GGTGGCAGCGGCCCTGGTCGCGCCGGTCTGAACGGCGGCCGCAACAGCTCGCGCATAAGCGACTTCAAGCACTACATCGA
CGCCGAGAAAGGCTGGATCACCTTTGAGGGTGCGGCCACCATCACGCGGACCGGCGTCAACTTTGCCGGAGGCCACACTT
TTAAGATATCACTGGACGAGATCCAGGTGCTCGAAGAGCTGGGCAAGGGCAACTACGGCACCGTTTATAAAGCACGTCAT
GCAAAGCCTGCAAAGCCGCGCTTTGGGCCAGGCCTTAGCGGCTTCAAGCAGCCACACATCCCTCCGTCCAGCGTCTCTTC
CATTTCCCCGCCCACCGCTTCACCACAGCAGTCACTAGCCGGCTCGGCGAACAGCCCGGCGATAGGCGAAGGATCGGCCA
GCGCCGACTCAGCCAGCCGGGGACCCGCTGCCGATGCTACGACAGGCAAGGTGATGGCCATGAAAGAGATACGCCTGGAG
CTGGACGAGGCCAAATTTACCACTATCCTCAAGGAGCTGGTTATCTTGCACGAATGTGTGTCGCCGTACATTATCGACTT
TTACGGTGCCTTTTACCAAGAGGGTGCTGTATATATGTGCATCGAGTACATGGACGGCGGCTCCATTGACAAGCTCTACG
CCGGCGGTATACCCGAGCCAGTTCTGCGCAAGATCACATACTCGACCGTGATAGGCCTCAAGTCGCTTAAAGACGAGCAC
AACATCATTCACCGCGACGTCAAGCCGACAAACATCCTAGTGAACACGCGTGGCCAGGTCAAGATTTGCGACTTTGGCGT
CAGCGGCAACCTAGTCTCGTCTATAGCAAAGACTAACATCGGCTGCCAGAGTTACATGGCACCCGAGCGAATCTCTGGCG
GCAGCTTGGCCTCAGGCGGAGCAAATGCGCAGGGCACCTACAGCGTCCAATCCGACATCTGGAGTCTCGGCCTGACAATT
ATCGAATGTGCCATGGGCCGCTATCCATATCCACCCGAGGTGTCCTCTACCATCTTTAGCCAGCTAAGCGTGCGTACAAC
CCCTTCATCTTTGTGTTTCTGTGCTTGTGAAACTGACGTGTTTTAGGCTATCGTTAATGGCGAGCCGCCAGTGATGCCCG
ACAATTACTCAAGCACGGCCCATGATTTTGTGCGGTCGTGCCTCAACAAGAATCCGCTGAAACGGCATACATACTCGATG
CTTCTCAAGCACCCCTGGCTTAAGTCGCTGGCCAAAGATGAGACCATCGAGGAGGTAGAAAACGAGGATTCTACTAGCAC
CGGCTCGGATTCGGACGACGTGGTCCAAAAGATGGAATCTGTCGATCTGTCCACAGAAGGCTCTGAAGATGTATCAGATC
CCCCTCCCGTCGCAGGCGACGAGGAGGTTGCAGCCTGGGCTGTCGAAGTGCTCGAGAAGAAAAAGAGTGGAAGTCTGGGG
ACGGCCGGTGAGACGGCCAAGCCCGCCTTGCACACTGCTCCCCTGGCGCCTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62