GenePrediction:GLEAN_6574 Details

Name: GLEAN_6574
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:1405037..1402154 (- strand)
Length: 2884
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:1405037..1404874 (- strand)
Length: 164
Type: CDS
Source: GLEAN
Position: GCSC_156:1404716..1403338 (- strand)
Length: 1379
Type: CDS
Source: GLEAN
Position: GCSC_156:1403082..1402154 (- strand)
Length: 929
>GLEAN_6574 class=GenePrediction position=GCSC_156:1405037..1402154 (- strand)
ATGGCTTCCGGCTGGGCAACAGGCCGCGACTCAGTGTCGGCAGTCGACCCGACATATGGACAGCGCAGTGTCTTTGGAAT
CGCAGGCCAGGCGACGGCGATCGCAGATGAGGATCTCGACGTCGAAGACGAGCAGGAAGCTCTGGACTATTTGCGTCTCG
TACGGTAAGCTATCACCAGCGTGCCCCTTGTTTCGAGCGAAGACGGCGTGTGACAGTGCAGTTGGCTGAGACTTTTTCCT
CTGTTCCCTTTATATCTCTCCGTGCAGCCGAATACCGACGTAAACAAATGGTTTTACTGATCTTGCTTTGGTGGCCGACA
GAGCGGAAGCTGGCAAGATTCCCCACGTGATGATCGCGCCCCGACATGGACCACAGGCCTTCCCACGACACGTGACGGAC
TCGATGGTGGAGGGGAGTGGCGTATCGAAGCAGAAGCGGCGGCGACGACGCCGTCACTGGGACGAGCAGGACGACGGCCA
GAGCGCGGCCAAGAGGCCGTGCCTGTCAGGCCAGAAAGGCGCACCGGCAGAGCTGTCGTACGACGACGAAAGTGAAATGG
CAGTCGTGGCAGCAGCGGCCGAGGACAAGGGAGGAGAGGCCGAGGAAGGCGAGGAGGCAGAAGCAGAAGCAGAAGCAGAA
GCAGAAGCGGAAGACGGCGAAGAAGGCCAATGCCACGAAAACGAAAACGAAACCGAGGGGAGCCGACGCCAGCACTACTA
CGACCACTGTCTCTACGAAAACGGCGTGGGAGACAGCCGCGGCTACTACCAGAACGGGGCCTACACGGCGGCGCCCGAGC
CGGCAGCGTTGGGCGGTCAAGGTCACGGGAGAGAGGCTTTCGGGCAGCTGGACGGATCTGTCGGAGGGGGCGTCGACGCG
GAGACGGCACGCTTCAGCGCGGTCTTCCGCGAGCAGCTGCTCCGGCGGTTCGGTGAGCTGCGCACGCTGTTGCAGCAGGT
GCCGCCGGCCGAGGCAGTGGCGACGCTGCCGGCCGGCCACGACACAGCGGTGGCGCCGCTCAGCACACGATCGGGCGCGT
ATGCGCGCTGGCTGCTGCTGCTGCAGACGACAGACCCGCTGCCTGCCCAGATGGCGGCCATGGACCGGGTCAGCGCATTC
CGGCTGCTGCGCGTGCTGCTGCGCGGCCTGCTGGTCGGCGGGTCAGGGTCGTCGCGGTCGTCGCGGTCGGGCCGGTTTGC
CCGCTGGCTGGCCGGCAGCAACAACAGCAAGCCGGGACGTGGCCGGCACGACCAGAAGGATGGGCAGCCGGCCGGGCTCG
ACATGGATGACCGCACGAGCCGGTGGCTGTGGGCGGTGCTGGCACGGCTGCCCGATCGGGGCGAGCTCGGGTACGTGGAG
GTGGGCTACATCCGGGACGTGGCGAAGCAGGCGGTGATGCGGCTGGCACATCTGAGCTACGACGTGGAAGAGGGCGAGGT
GGAGGACGGAGGGGGGGAGGACAGAGAGAGTGAGGTGAAAGAAGACGAGGACGAGGCAGAGGATATTGCCATGGACGTGG
AGTCAGAACCTGAAGCAGGAACAGAGGTGGAGACTGCAAAAGGCGAACCAACCAAACCAGTCACCCTCGAAGACCTGGAC
AACGCTGTCGATGTCGACATGTACCAGAGGGCAACACTGGAGATGGTGCTGGCAGTGGCAGGCGAGTTCTATGGGCAGAG
AGACCTGCTAGCCTTTCGCAGTCCGTGGCCGACAAGTCGGGCAGCATGAACAGCATAGAAGATACTTTTTAATTGTATGC
TTATATAATCTCCAGTTGGTTCGAAGCTGTCGCGTGACAGACGGCACATGAATGTAAGACGCGACGCGAACGCGCTCACT
TTAATTGGCCCTAGTCCTCTTTCGGACAAACGCCTTGCCAGCCACTCAACCTTGCAGCCATTGGCTTTCCTGCTTTCATC
TGCTGCTTCCCACTTTCCATCCTACTTTTTGTCAGCCGTCTGCAACCGGTCCAGGCCCCAAGACAAGCAAAGCCTAAGCC
AACCGCTCCCGGACGAGCGAAGCACACCGAGCAGACAGGCTGCGACCATGCCGACGCACCGCACCAAGCGACCCTTTGCG
GGCGCAGCCAGCGATCCGGCGCAGCGCCACATTACCAGTTTTTTTGTCTGCGACGACGAAGCGACGGCCGTGCGTGCGGC
CACGCACAGCAGCCACGACGACGGCAGCCGGTCTGCGGCGTCGGTCGCGTCTCTGCCGCCGTCCGTGCAGGCCGACCTTT
TGGCCGTCGGCATGCGCGTGCGCAAGTCCGTGCCCGAGGGCTACAAGACGGGCAAGGAACTATGGCCAGCAGCGAGACAC
GGACCCGGACACGGACACGGACCCGGACACGGACATGCGGGCGGGTTGTCGGCTGCTGCACAGCGCGAGCTGCTTCCGTT
CTGCGGCATCCACCGGGTCGGCGGGCTGGGCGTGCAGTCGTTGTCGACGGCCGACGAGGGCGACGAGCTGTCCGGCCACC
GCGACGTCGATCCGGTCGATCCGGTCGAGCCGCCCAGCCTGACCAGCAGCCAGGAGACGGTGTCGTCGGACGACGGCATG
GACCTGTGCCCGCCACCGGCCACGCGCAAGCGTCTGTACGGCAGCCCGTCGGACGACGACGATGACGACGACGACGTCAA
CGAAGACCGCCCGGCGGCCTGGAGCACCACCGGCTCCATTCCACAGAACCGACGCCTGCTGGCCGTGCCGCGAAGACGAC
TGCCCCAGACCCAGACCCTGCTCTGCTTCTCCAAAGCAGGTCGAGCCGACGTCCGGATCGTCGGCCAGGAAAACGTCAAC
GGCGCCGACGACTTTGACGAGGCCCCCTTCCTCGACGCCAGCACCTGGGCTGGCCAACCAGACATGGACTTGGACGGCGT
CTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62