GenePrediction:GLEAN_6575 Details

Name: GLEAN_6575
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:1392600..1387654 (- strand)
Length: 4947
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:1392600..1392292 (- strand)
Length: 309
Type: CDS
Source: GLEAN
Position: GCSC_156:1392211..1391830 (- strand)
Length: 382
Type: CDS
Source: GLEAN
Position: GCSC_156:1391778..1391502 (- strand)
Length: 277
Type: CDS
Source: GLEAN
Position: GCSC_156:1391434..1387654 (- strand)
Length: 3781
>GLEAN_6575 class=GenePrediction position=GCSC_156:1392600..1387654 (- strand)
ATGGCGTTTCTATTCAAGTCCAAGAAGCACCAGGACCGGGAAAAGGATCGTGTCTTGACCAGCCGCGAAGGTCCAACGTC
CGGTTCGCAACAGTCGTCCGTCGCCAGTATCGGCGCCCGGATAGCAAAAGACGAAAAGCCCTTTCAACGATCCACCCCGA
ACGGCAGCCTGAACTCGCTCGACAACGACGCCACCGGCAGCCCAGACCGAGCTGTCAATAATCGCCGGCCGCCCGTTGCT
GAGCAGACTCCCCTTACGGCTGCACCAGCAGCTGCTCAGGGCCAGCCACCGCCGGCCGGTGATCTCCAGGTATGCTGACA
CGCGTGCTCTCCCGGCTCCCGCTCCTCTGTTGCCGTTTTCCTTTAGCCGTGCTGACAATTTGTCCTCAGTTTCGCAACGG
CCCTGGTCCAGCCGTCGGCAGTTCCAACATGTCCTTGTACCCCTGGTCACAACGGCGCCTCACATACACCTCGTCAACCG
TCAGCCCATTTCCTCGGTATGGGGCCTCGGTCAATTCCACTGCGTCGAAGGAGGGTGACATCTATGTCATGGGCGGCTTG
ACCAACAGCCAGACCGTCAAGGGTGACCTCTGGATGATCGAGGCCGGCGGCAACATGTCGTGCTACCAGCTCGCTACCAC
GTCTGAAGGCCCAAGTCCGAGAGTCGGCCACGCAAGTCTTCTTGTCGGCAATGCGTTCATTGTCTACGGGGGTGACACAA
AAATTGACGAGTCCGACGTCCTCGACGAAACCCTCTACTTGCTAAACACATGTAAGCGCTCGCCTCCCCTTTCCGACCGC
ACCATCGGCTGACTCTGTCCAGCCACGAGGCAATGGTCCCGAGCTCTCCCTGCAGGGCCACGTCCTTCCGGACGGTACGG
CCATACGCTGAACATCCTTGGATCCAAGATCTTCATCTTCGGCGGCCAGGTTGAGGGCTTCTTCATGAACGATCTTGCTG
CGTTCGATCTGAACCAGCTCCAGATGCCGAACAACCGGTGGGAGATACTGGTGCCCAACGAGACTGGGGCTGCTCAGGGC
AAGATCCCCCCGGCAAGAACCAACCACACAATAGTGTCATACAATGACAAGATGTACCTGTAAGTCTACTGCAGGCTGTC
TAGCGCTCGTGTTTTGTCTGGACCGCGTCTAATTTCAGTCCAACAGCTTCGGAGGTACGAATGGCTTCCAGTGGTTCAAC
GACGTCTGGTGCTATGACCCTGTGACGAACAGCTGGTCGCAGCTGGATTGCATCGGCTATATTCCCGTCGAGCGGGAGGG
CCATGCCGCCGCTCTGGTCGACGACGTAATGTATGTTTTTGGCGGTCGGACGGAGGAAGGAGCCGACCTGGGTGACCTGG
CCGCGTTCCGGATCTCCTCCCGTCGTTGGTATACGTTCCAGAACATGGGGCCGTCTCCTTCCCCTCGATCCGGGCACAGC
ATGACGGCCGTCGGAAAGTCCATTGCCGTGCTAGGCGGCGAACCAAGTTCTGCCACAACCACGGTCAACGACCTTTCGCT
CGTCTATCTCCTTGATACCAACAAAATCCGCTACCCGAACGATGCTCAGATTCCGCCGAACGGGACCAGACCACCGAACG
GGCAGAGACGACCAAGCGATGCGACCAGAGCCGTGCAGCCTCGAGACGGCTCTCAGGGTCCAATCTCTGGCGACCATAAA
CGGCCAATGGGTCCAGGGGGAGGCCCAGGGGGACCTCCAGGGGGGCCTCCACCTGGAGGTCCAGGTGGTGGCCCTGGTGG
CCCTGGTGGCCCTGGTGGAGTGGGTAGTCCCATCAACGGTTACAAGTCTCCCAACGGACTTGACACGAACCCCGGCGACG
GCTCGAGCTCGCCCGTCAACGGAATGTCCAAGCTGCCTAGGGCCGCAGGACCATCGCCGCCAGCAACATCGCCACCCCAA
GGACAGTTGCCAAAGCCGAATCAGCCTCACCCTCCAAATCAGGGACGACCTCGAAATGCGTCAGCAGAGCGCGGCGGCTA
TTCCGCCTCTCCTGCTCGAAGCAACTCGGGCTCGGCCCAGTCGCCTGGCATGCGTGGCAGTCCCCGGGATGTCAACGGCT
TCCAACAAAACGGAAATCGGCCCCCACTGTCGCAAGGCCTGAGACCAGGTCCAAGGGGAGATCCTGCGGGTGCACCACAG
TCCGCAAGGCCTCCGCCGGTTGCAACGGGTCCCGAGGTGACAGGAGCGGCGTCTGCGGCTGGAGGATCAATGGCTTCGGC
AGCAGCAGCTGGTGGTGCAGCGAGCCCGGTCGCCTCACGACCCAGAGGCCCGCCTGCACAAATGTCGATGGACAATGCTG
CGGATATGGCTGTAAGACAGGCCCCTGTCAACCGGCCGTCTTCACCACCGCCGCCAGCCCGACAAGGTGGCGGCAACCCG
CTCGCGCGGCGGTCGTCTAACCGCAATTCGCAGACGGTTGCCGTCCTTAAGGAGCTGGATTCTGCGAGGAACCGGAACGC
CTGGTACGCTTCCGAGCTCGAGCTGGCCCGAAAGGCGGGCTACGTGTCAAACGCATCCCTCAGTCCCCTTCTTGACGGAC
GTGGCTCCGAAACGTTTGACGACGACGACAAGCCCCTGATTGAAGCGCTTCTGGCGATGCGGACGGAGCTGGCCAACGTG
CAGGCGTCAGTCGACAAGCAGGCAGTTCTCGCTGCGAAGCAGATTGCAGAAGCCGACAAGCAGCGTGATGCTGCCATTCA
GGAGGCTGTCTACGCCAAGGCCAAGCTGGCGGCGCACACCGGGACTGGCAGCGCAGCGAGCACACCTCAGCTGGACAGGG
ATCGCGATATTGCAGACCGGGCGACGGACATCAGCCGCAAACTCGCCACGGCCTTGGCGTCGCAGAAGGAGCTGCAAGCC
CAACTGGACCGCAAATCGGCTGAAGCTGACGCGGAGAAGCGGTCACGGAAGCTGGCAGACGACACGCTGGCGGCTGCGCA
GCGACGAATGACGGAGCTAGAGAGCTACAAACAGCACACGTCGTACGAGCTGGAGGGCCTGAAGGCTGAGCTTCACCGTG
CACAGCACGAAGCGCGCGAGGAAGCGGTCAAGGCGGTCGAGGCTGCAGCGGCTCTGGAGATGCTCCGTATAGAGAAGGAG
GATTTCGAACGCCAATACAACGACGCTGCCGGTAACGCAAAAGAGACGGACGACTCGTTCGAATCCTTGCGTGAGGCCAT
GGTGGCATCGGCCGACATCAAGACAGTCCTGGAACAGAAGCTACTACAGGAACGAGCGCAACGGGAGGAAGCCGAAGCGA
AACTGGTCACTGTCAAGGCTGAGCTGGAAGGCCGCACAGTGGAGGTGATGACGCTGACGCAGCGGCTACGCGATACCGAA
GAGCTTGCGGAGAGACATGCCAGCGAGTCCCGCGCTCACCGACTGGCGATAGTTAACGGGCTGGACAAGATGAAGAGCCG
CGACCTGTCGAACACGTCAAACAAGGCGGACACGGACCGCATCGCAGCGCTGCAGAGCCAGCTGGAGGCAGCCAAGGTGC
TGGCAAAGAAGCACCACCAGGATGCCGACACGGCATCGGACAGACTGCGGTCGGCGGAAGAACGGATTGCCGGTCTAGAA
GCATACCAAGAGCAGGCCAGCCGCGAGGGCGTGACGATCCGGCGACAGCTGCAGGGAGCGCTGCGAGAGACACAAACGCT
GCAGGCACTCAGCAGCGACCTGAAGCACCAGCTCTCGCACCAGCAGCTGGAGACGAACGCAGTGACGGTGCAGCACAACA
CGCTGAAGGAGATTCTGAGCGAGCGAGGCATCAGCCCGACCAGTTCGGCGCGTCCCCGAGGCAGCCCTCGCGAGGGCTCG
CCGGAGCAGGAGGCACGGATCCGCAATCTAGAGCGACAGTTGTCATCGGCGTTGGCAGGCCACGAGGAGACCAAACAGCT
GTATTCGGCACAGGCGACAGAGGCAGAGACGCTGTACCGCGACAAGCTGACACAGCTGGAAAACGACTACCAGTCAGCGG
TACACTATGTGAAGGGCACGGAGAAGATGCTGAAGCAGCTGCAGGAACAGCTGACACGGTACAAGGCCGAGAACATGCGA
CTGAAGGCCGAAGTGGACGAGCTGGAGGAGACGCGGGCGCGCAGTGGCGGTGGAAACTCGATGCCGGCCGACTGGGAGAC
GGAGCGCCTTGCTCTGACGGAGAAGGTCGAGGCGCTGCAGTCGGATCTGGAATTGGCACAGGCGCAGCTGGGCAACGAGC
TGCAGCTGGTGCGACAAGAGCTGGAGGGGGTGAAGCGCGAGCGCGATGCAGCGGTACGGTCGGGCGAAGAGGCGACGACG
CGACTGGCATCAGCACGACACGACTACGAGCAGCTGCACCGGGAGAGCACGCAGCTGGAGCGGCGAGCACAAGACGCCGA
GATGAAGGTGGGCATGCTGCTAGACCAGGTGGAGTCGTCGGTGGGAAACTACCGTCGAGTGAGCCGGCAGATCACCATCG
TCGGACCGGACCAGTTCAGGGACCTGAAGACGGGCAGCGGTGGTTCAACAGCAGCAGCAGCAGCAGCGGGTCTAGAGCGC
GGCACACTGGGAAGCACACTGGGCGGCACACTGGGTGGCACGGCAGGCGGCCTGGCGCCCATGGCAGCAAACGGGCAGCT
CGGAGGAGGCAGTTTCGGACACGCACGACAGGACAGCTCGGAGGCTGGCAGCACGTACGGCGAGGCACGCAACAGCGCGG
CGCTGGACAATCTCGCCAACGAGCTGGAGACGCTGCGCAGCCACTGGGAGGCGACCAACAAGAACTACCGGCTGAGCAAC
GCGTTCGATTTTGACAATGGAGGCGCGGGCGGTGGCAACAACAACGGGAGGGCGGCATCGTCGTCGCCGACAAAGGACGG
CAAGGAAGACGGCGGACTGGGGCTGAGCGAGAGCCTTGCGGACTGGCGAAAGCGGCTGGACAGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62