GenePrediction:GLEAN_6576 Details

Name: GLEAN_6576
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:1386034..1385150 (- strand)
Length: 885
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:1386034..1385982 (- strand)
Length: 53
Type: CDS
Source: GLEAN
Position: GCSC_156:1385791..1385742 (- strand)
Length: 50
Type: CDS
Source: GLEAN
Position: GCSC_156:1385673..1385150 (- strand)
Length: 524
>GLEAN_6576 class=GenePrediction position=GCSC_156:1386034..1385150 (- strand)
ATGTCGTTCCTCTGTGGTGGATCAAAAACGGCACAGCGCAAGCTGGTCCTACTGTAAGAACAGGCGGATGTCCGACCGAT
AGGGCAGAGAGACCAGCGGCCAGTGGAATGCTTGCTAATACTGCGCGACATAGAGGAGACGGAGCTTCGGGAAAAACATC
ATTACTCAATGTCTTTACGAGAGGGTACGCGTTTCTGTCCGTTTGCGGCGGCAGGCTGGCGGAGAATGCTAACCGGACTG
CAGCTACTTCCCGACCGTCTATGAGCCAACAGTGTTCGAGAACTACGTACACGGTACGATCTGATTGCAGGCCAAGGCGT
AGGAGTGGACGGATGCCGGGATGGAGGCTGACATGGAGCAGATATCTTTGTCGACAATGTGCACATTGAGCTATCGCTGT
GGGACACGGCAGGCCAGGAGGAGTTTGACCGGCTGCGCAGCCTGTCCTACGACGACACGGACCTGATCATGCTCTGCTAC
AGCGTCGACAGCCGGGACAGCCTGGAGAACGTGGAGTCGAAGTGGGTGGGCGAGATCGCGGACAACTGCCCGGGCGTGAA
GCTGGTGCTGGTGGCGCTCAAGTGCGATCTTCGCGAGGCGGACGACGAGGAGGCCAGCGAGGGCGCAGCGACGCAGGGCG
GCGCGGCATCTGGCGGCGGCGAAGACGGATCGGCAGCGTCGGGTGCAGCGCCGGCAGCACGCGAGAAGAAGCCGATGATC
ACATACGACCAGGGCCTAGAGGTGGCGCGGCGCATCAACGCGATGCGGTACCTGGAGTGCTCGGCGATGCGCAACCGGGG
CGTCAACGAGGCCTTTACGGAAGCTGCGCGCGTGGCCCTGAGCGTGCGAAAGGAACGCGAAGGCGGCAAGTGCACCATCA
TGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62