GenePrediction:GLEAN_6578 Details

Name: GLEAN_6578
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:1381064..1379478 (- strand)
Length: 1587
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:1381064..1380801 (- strand)
Length: 264
Type: CDS
Source: GLEAN
Position: GCSC_156:1380725..1379478 (- strand)
Length: 1248
>GLEAN_6578 class=GenePrediction position=GCSC_156:1381064..1379478 (- strand)
ATGTCCGACGACGATTTCATGCAGGCCTCTGACGAGGAGGAGTACGACTTTGAGTACGAAGACGACGAAGACGAGCTGGA
TGCTGGCGAGGTGACGATCGAGAACAAGTACTACAATGCGAAGCAGACCAAGTTGACGGATCCAAGCGAGGCCATTGTGG
AGTTCCTGGGAATCCCGGCGCTGGAACCGCAAAAGGCCGACTGGGGCTTCAAGGGACTGAAGCAGGCCATCAAGCTGGAG
TTCAAGCTAGGGCAATACGAAGCAGTGAGTTGTCTTCTCTGCTGTGCTCTCTGTTCGTTTGTTCTCTATCCTGCTCATTC
TACACAACTAACCTCCAAGGCTGTCGAACACTACAAAGAACTGCTCACGTACGTCAAGTCGGCAGTGACACGCAACTACT
CGGAAAAGTCGATCAACAACATGCTCGACTTTGTGGAGAAGAACTCGGCCGGCAGCGAGCAGGCAGGGCCGTTTTTGGGG
GGCTTCTACGACCTCACGCTAGCGTGCTTCCAGAGCACGAACAACGAGCGGCTGTGGCTCAAGACGAGCGTCAAGCAGGC
CAAGCTGCTGCTGGACCGGCACCAATACGTCGACGTGGTGCGCAAGCTGCGCGAACTGCACCGGGCCTGCCAGCGGGCAG
ACGGGACGGACGACGCGAGCAAGGGCACGTACCTGTTGGAGATCTACGCGCTGGAGATTCAGATGTATGCGGAGCGCAAG
AATAACAAGCAGCTCAAGCAGCTCTACCAGCGGGCCCTCCGGGTACGATCAGCCGTGCCGCACCCCAAGATCATGGGCAT
CATTCGCGAATGCGGCGGCAAGATGCACATGAGCGAGGAGAACTGGAAGGACGCACAGGGCGACTTCTTCGAGTCGTTTC
GCAACTACGACGAGGCCGGCTCGCTGCAGCGCATCCAGGTGCTCAAGTACCTGCTGCTGACCACAATGTTGATGCGGTCC
GACATCAACCCGTTCGACTCGCAGGAGACGAAGCCGTACCGCAACGATCCGCGCATCGCCGCCATGACTGAGCTGGTCGA
GGCCTACCAGCACGACGACATCCGTCGCTACGAAGACGTCCTGCACCGCCACCCGGACCTGCTGCAGGATTCCTTCATCG
CCGAGAACATTGACGAGGTCACCCGCACCATGCGGACCAAGGCTGTCCTGCGCCTCATCGCCCCCTACACCCGTCTCCGG
ACGGCCTGGATCGCCGACCAGATCCGCATCAGCGACGCTGAGGTCCACGATATTCTCGGTTACCTCATCGTTGACGGGCG
CATCGCTGGCACCATCGACCAGCAGGCCGGCGTCCTCGAGCTGCAGTCGGCCGTCGATGCCGACCGCGTCGAGGCTGTCT
CTGAGCTCACCGACGCCGTCATGGGCCTCGCCCGTGCCGTATTCAGCAACACTGCCACCCAGCTGCGTCCGGGCGCCGCC
TCGGCCGACGGCACCAACGCCGGCTCTGGCCCGCCAGACCCGTTTTCCAGCGCCCCGGCGTCACCCTTTTCCGTCCGCCA
CAGCGGGCGCCATCCGCGCTCCGGAGCAAAGGGCCTGGCCGGCAGCCGTCGATCAAAGCAGGGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62