GenePrediction:GLEAN_6580 Details

Name: GLEAN_6580
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:1376324..1373085 (- strand)
Length: 3240
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:1376324..1375185 (- strand)
Length: 1140
Type: CDS
Source: GLEAN
Position: GCSC_156:1375124..1375038 (- strand)
Length: 87
Type: CDS
Source: GLEAN
Position: GCSC_156:1374968..1374923 (- strand)
Length: 46
Type: CDS
Source: GLEAN
Position: GCSC_156:1374745..1373085 (- strand)
Length: 1661
>GLEAN_6580 class=GenePrediction position=GCSC_156:1376324..1373085 (- strand)
ATGCAACTGCCCGCTTTAACGCCGGTTGAGATAACGGTGGAGTTCACCGATGTCGCTAGCTTCCAGCGCCTCCAGCTCCT
TCAGCGCCAGTACAAAGAGCAGTCAGGGCAGCAGGAGCGAGAGCGACAGGAACGGCAGGAGAGGGAGGAAGAACAGCGCC
AGCAGTTAGAATACGAGCAGCCTTATCAATTGCACTACCAGAACACCTTTTTGTACCAGCAACCACAGTTCCAGCAGCAG
CAAAACTACCATTACGACTACGATCACCAGCAGCTCGAGCAGCTCCAACAGCTCCAACTGCTCCAACAGCCTCAGTACCC
ACCACCGACACAGCACCAGCACCAGCAGGCGCTATTCTACCGGATTCACCAACACGCACAAGCCCCCGCTGCTAGCGCTG
CTGCTCCCCCACAGCCCATCTCATCGGCCTGCGACGACAGCGGGGACGGTGCTGGCGGCCTGTGCGACGAACCGAACAGA
TGCAGAAACAGAAGCGCGGTTCCAGCAGGCGCTATGGTCAGCGGAGCTGCAAGCCATGTGGCAGCTGTCAACTACGTCGG
TTGTGCCACTTCCTCCTATACCGCCCTAGCCTTCCCACAGCATCAGCGCCTGCCCTGCGGCGGCTGCACCGCAAACGGCA
GCTACCACTACGGCACCATCAACGCCGACTTCGCCACAGCCCACCACCGGCTCCAGCAGCCACCGCCACAGCAGTCCACA
GCAACGCGCCCCGCCCTTGTGTCTAGCGCCACCAGCCTTGCTGTTCTTGTTCCCCCCGCTGCCGTCTTTTTATCCTCCAA
TGCCGCCTCATCTCCATCTGCCCCCCCTCATCCTCATTCTCATTCTCACCCTCACCCTCGCCCGCACCCTCTCGCCCTCC
CCTCATCTCCGCTGCAGCTCCGTCACTGCCGCCTACGGCTGGCCCCGAGACGCCAGGCCAAAGCCAAGATCTCCCACAGC
CAACCCCACGCGAGTCTGTATCGTCCCCTTGCGCTCGACGAACTACATACTCCACTCCCACACCCGCTTTCGGCCATGGC
CGTCGATCTGCCCGAGATGACGGGGGACAATGCCGACCATATCGCCGCCGACATTGCTACGCAAGAGGCACTAGCCCGGG
ACTACCAACCAGACGTTACCGTGCGTGTCGCTCTCGCTCTCCTCTCTGCCCGGCTTGCACTCCTCCTAACCTCTCGGTAG
GGCCCAGCTGTAGGCAGCATCCAGTCGACCGACGTCGTCAAGGAGCACTATGCTACCGCTGATGCTGCGTTCGCCGAAAA
GACCGGGGTACGTTGAGAGCTCCAGAGAGCCCCCTCTGTTCGGACTTCCCCCGAGCTGACCTCTCGTCGAATGCAGACAT
TGCCAGACATCTTCCCTCTCTACCGTTCCATTCTCGGAGATGGTAATTGTGGATGGAGAGGTATGGCAGTCCCGTTTCTT
ACCAGTCATATCTGCCCCTCTCTCTCCTCGCTCTGTCTCCTCCGTCCAATCGTGCAGATTCGTGGAAAATGACGCGAACG
CTGTGCGGTGCTGGGCATTGCTCTGGGCTGACTCGCGTGGTCTTTTTGACCCTCCTTAGCAATTGGCTTCTGTTACTTTG
AAGCGCTGATCCATACCGAGAACATGGACCGGATCAAGAATGAGCGCAGCCGATTGCAGAGCCTGAACGATTACATCCGT
GATGTCGGGCATTACAACCCATATGTCTATGAGGACATGGTTGAGGAGACTGACAATCTCTTTGTCAAGATAATCAATGC
CATGCCTGAAACGGACAAGGCCGCCACGGCATTGACGAACATCTTCAATGATGCCAACTCAGGGAACGCCATCATCTACC
ATCTGCGGCTGCTAGTCGCCTCATATCTCAAGGGAAACGCCTTGCTCTACCAAGATTTCCTCATACATCCAGACGGCCTG
GAAGGCTATTGCCAGGAGTATATTGAGCGGCCAAACTGCGAAATCGACCACGTCCGGATCGAAATACTGGCCAACATTTT
GCTCAAACCGCCTGACATTGTCCTGGAGATTGCCTATCTGGATCGAAGTGTGGGCTCCAACGTCCCCCTTTACCGATTCC
CCCAGGAAAACAACAACCGGGAGGAGAATTCCATCGACTTGCGCATATCTCTGCTGTTCCGACCAGACCACTACGATATC
CTGTACCGCCCTGGTCTACCTTTCGCCAGCGTATCCGCACCTGGGCCTCAAGCTTTTGCACAGAACCCTTCCGGCTCATC
ACCTGACGCTTCTGCCGTGCATATTACCCCGGCCAGGCTGGCTGAGGAAGGCGGCAACTTGGATTCAAAGCGGTTAGAAC
CCGTCGAGGGTGCAGCCGTGCACACGACTCTGAGCGGTCCTCCTGACACTGCTGGTGGCCAAGCTGCAGCTGCGGAAACA
CCGGAGCCACCTTTGGATCCATCGTCCGCTGAATCCTCCGTATTGAACCCGCCGTCATCTACAGATCTTCATGTGCATCA
CACTCGCGTTGACTTCGAGTCCTTGTTTCCCTCTAACACGTCGAGCCTCGAAAACTATGCAAACCTCGATATGCGGGTGC
TGAGCCTCATCCCAGGCATGATGACAACAGCTTCGGCGAGGCCAAACTATTCCTCGTCTCTTGGGTTGCCTTCTGGCCAG
CCAGAGCTGTCCCAGTCACCCTGGGCTGCCTCAACGAAAACCGGCTTTGGCGGCAGCTTGTGCACTATCTCGGCATCAGA
GTCCCATGCATCAATACTGGTACACTTGGCAGTGGCAGAGTCCCCATCGATGGCATCGGTTGAATCTTCTGTGGCAGCGG
TGGGGCCAGCTTTGGAGCCCGTGAGCCAATATGCAGGACGTATCAATAACAACATATCTATGGAGGGAGCCCCAGTTTCA
TATTCTGAGGTCCTGGACCCGTCGGCTGAACTGTCGGACTCGGTCCACCTGCATGCCCAACGTCAAATGCATTTACCTCC
ACACCATCAACAGCAATTCCATGGTGGACATACGCCCGAGCCAGCCGAGTCCCATCCGGTGCGCTTTACGAAATGGCAGT
ACGAGAGAACCGATATCGATATCAACAATCCAGAGCCGGGATTTCTCCGGAGCTCTCGGTCCAGCACAGCGCACTTTTCG
AACCCCGAGTTCCAGCCAGAAGAGTACCAGCCAGCCGGTGAGGACGGAAAGCTCGGGAACTCACGTAGCAGACGAAAAGC
CCGCCGGCTCTCCAGTGAGAACGCCCCGAGGAAGACCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62