GenePrediction:GLEAN_6582 Details

Name: GLEAN_6582
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:1333576..1330365 (- strand)
Length: 3212
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:1333576..1330472 (- strand)
Length: 3105
Type: CDS
Source: GLEAN
Position: GCSC_156:1330409..1330365 (- strand)
Length: 45
>GLEAN_6582 class=GenePrediction position=GCSC_156:1333576..1330365 (- strand)
ATGACAGCGACGATGCTACGGTCCGTTTTCCTCGCCGCTTTAGTGGCATTGCCATCTGTGCATGCGACCTACCGAGACGA
GGTGGGCGACATCGACTTCCAATATGACTTGGTCGGCGTGCCGCAGGAGCAGCAGACCTTTTTCCACCGTCCGCGACCGG
ACGACCGGGCCAGCCTGCTGTACACGCTGAGCGATGTGGGTGTTCTCGGGGCCGTGAACCCGGGCAGCGGCGCGTTAGTG
TGGCGACATCTGCTGGAGGACGAGAGCGACGAGAGCTACGATGCCACGACGACGGCGACGACGGGCAAGACATACACACA
AGCGTCTGGGCATGGCCGGCTGGCGGCAGTTGATGGCGAGGGCTGGCTGGCGGCCGGACTGGGCAGCTCCGTGCACGCCT
GGGCAGCTCTTTCTGGCCGTTCGCTTTGGTGGATGGATTTTGCTGGAGAGCTGGTCGGCCTGGATGTGGTGGCCGGCGCA
GCCGATACGGCAGCCTCCATCTTGGCGCTTTTCCGCGAGGACGGGCCGGCCAGCACGGCGACAGTGCTCCGACAACTCAG
CAGCGACGACGGCCGTGTATTGTGGGAGATCCGCGACGCAACGCCGGCCGGCATCAGCCAGCCGCTACAGGTGGTGGCCG
CCTCGGATGGCCGCGCCTTCGTCATCAGCCTGCACAGCAGCGCTGGCCTGCGGGCCGTCGCCGTCGACCTGCAGACAGGC
CGCCGCCTGGACGACTTCGTGTTGGGCGCCCGCTCCGGCGCCGACGACCTGCGCTCGCCAGCTGACGTGCTCTTCATCGG
TGGCCCGGCCGCATTGCCCTTTGTCGCCTGGACTGACAGCGCGCGCTCCAAGCTACGCGTCAGCTGCTTGCTCTCTACCA
AGCCGCAGAAGCACGAGTTTGCCCTGCCGACAGACTCAGCTGAAGTCATCATTCGGACGCCTCGCAGCTTGCCCAAATCG
GCATCTTTGGCTTTTGTCGTCCACACACGGACAGAGGCGAAAGCTGAAAGTGGCGCCCTATTCCATAGCGGGCAGGTCTA
CAAGCTTGATCCCACATCAAAGTCGGTGGCAAAAACTCATGAGTTGCCACCTGCATCTGGCCCAGGCGCATTTGCCATCG
GCCTCGCCTCCAGAGATGCAGAGACTATATACATTACCCGCATCGGGAACTCCGAGATGTCACTTACGAGCTCAGCCTCG
CCTTCTATTTTGGGATCTTGGCCAATTACAGACAGCCGTATCCACGCGTTTAATTCGGCTGTGTCCGAGATAGTCACTAA
GCCAGCTGGCGACGGCAGCATCAGCTTCGCAGTTCGTGCGGCTGTCTGCACTGATACGGACGATTGGGTTCTGCTGCGCA
ATGGTCAGCTGGCTTGGTCGCGGCCTGAGGGTCTCACCGGTGCTTTGGCTGCAGCTCTCGCTGACCGACCGGAGTCAGAG
CAGCTGGTGCGGGCTCTCGAACAAGAGGCTCACAGCAACCCGCTTGCCGCGTACATTCACCGTGTGCGGCGTCACATCGA
TGACCTCGAGCATCTGCCGGCCTATCTGCAGACGACGGCGCAGCGAATCATCAGCAACATCCTGGGCAGCAGCAGCGACA
GCAGTGTTCCTTCGTCCGAGCCAGACTCGTTTGGCTTCCACAAGATTGCCGTTCTAGCGACCAAGCGCGGCCGCCTCTAC
GGTCTCGATGCAGCCAGTCCAGGCACGATCCAATGGACCAAGAAGGCAGTCGATTTGGCGCCTGGGGCCACCTGGGCCGT
TCGGCGTATCCACGTGGACGAGGCCCGGGGTGTGGCCACAGTCTTTGGCCAGACCGCCGCCCTGTCGGTGGCCGTGTACA
CAGAGACGGGCGAGGCCGCCGAGTCGTTGTCCTTGCAGATGCTGGAGGCCGCCGAGAAAGACGCCGAGATTGTAAGCACC
GCGCCCGTGACCAGCGCTGCCGGGTCGTGGGAGCTGGCCGTGCTGCGCGGCGGCAAGGTGGCCGGTGGTGATGGTATCCC
TTTAGAGCACTGTCCACGGGAGACCATCGTCGTGCGTGTTGGACAGCAGTTGCAGGGTATTCGTTTCGTGGTACGAGCGG
CGACATCGAAGTGCATTCCGGAAGTCACGTGGACCTTTGTTACACCAGCTGGCCGAATTGCCGATATCGCAGTTCGGCCG
GCTCATGACCCTGTCGCATCGATCGGACGGGTGTTGGGCGACCGCCGTGTGCTGTACAAGTACCTGAACCCGAACCTTGC
CGTCGTGGCCTCCGTCGATGAGGCTGCTGCCACGTTGACGACGTATCTCCTGGACACCGTGTCGGGACAGGTTGTCGCTG
CGGCAACGCATCTCGGCGTCGACGGCGGGAAGCCGGTTGAATGTCTGCTGTTTGAAAACACGTTTATGTGCACCTTCTTT
GCCGACTATCGCGTCGACGACAGCGCAAACATCGCCGCCACCATCAAGGGCTACCACCTGACCGTCAGCGACCTGTACGA
GTCGCTGGAGCCAAACGAGCGCGGCTGGGGAGCGGCGGCAGCAGCGGTGCGTCACAGCAGCAGCAGCAACGAGACCGCTG
CCTGGTTCTCCTCCTCGCTCGAGCCCGTCGAGGCCGAAGAAGGCGCCGCTGCCGTCGCCACAACGCTCGAGCCCGCCGTC
GTCTCGCAGACCTGGGTCGTCGGTGCTCGGCTGCGCGCCCTGGCCGTCTCGCAGACCCGCCAAGGCATCACCGTCCGGCA
GGTTTTAGCCTATCTGCCCGGAACACACGGCGTGCTGGGGCTTCCGCGTGTTGGCGCTTTCCTGGACGCTCGTCGTCCCG
TCGGTCGCGATCCCACGCCCGCCGAACTCGAGGAGGGCCTTACCCGCTATGCCCCTGCTTTCGAGGTTGATCCGCGCCTT
GTCGTCTCGCACGAGCGCGACGTCGTGGGCATCCGTGCCATTGTTGCCGCGCCCACACATGTCGAGAGCACCAGCGTGGT
CCTGGCCTTTGGCCGAGTCGATGTCTTTGGCACCCGCGTCGCTCCTAGCCTCACCTTTGATCTGCTCGACAAGAGCTTCG
GAAAGGCCTCTATGCTGGCTACTGTCGCCGCCCTGGCAGTCGGTGTTGCTGTTCTGCGGCCAATGGTGAGTTCAACCCCT
GCTCTTGCTTTTTGTTTTGTTCTTGTGTTCCATACTAACCAGCACAGGTCACAAAGAAGCAGATCGACATGCGCTGGCAG
GCACCCCTATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62