GenePrediction:GLEAN_6583 Details

Name: GLEAN_6583
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:1326997..1326025 (- strand)
Length: 973
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:1326997..1326163 (- strand)
Length: 835
Type: CDS
Source: GLEAN
Position: GCSC_156:1326101..1326025 (- strand)
Length: 77
>GLEAN_6583 class=GenePrediction position=GCSC_156:1326997..1326025 (- strand)
ATGTTTGGCGACATACCACCCACGCCCCTCAGCCAGGGCTCTCTGAGCACGCTGCTGCCGCCATCGTGGAAGGACCAGGT
GACCGTATGGCTGGCCGAAGACACTCCGTCGTTTGACTATGGCGGCTTCGTCGTCGGCGACGTGCCGCGAACGGCCACTT
TATGGGCCAAGAGCCCGGGCATCGTGGCCGGCGTGCCCTTTGCGGACGAGATCTTTGCGCGATGCGGCTGCACCATCGAG
TGGCACGTGGCCGAGGGCGACGCTGTAGGTGCAGCAGACGCACCCAAGACGCGGTGCGCCACGGTGTCGGGGCCTGCTCG
CGGAATTCTGCTGGCCGAGCGTGTGGCGCTCAACGTTCTGGCACGCTGCTCGGGCGTGGCCACGCGCACAGATTCAGTGT
TGACGCGGCTGCGGAAGGCCGGATTCTGCGGACGGCTGGCGGGCACGCGCAAGACTACCCCCGGCTTTCGGCTCGTTGAA
AAGTACGGCATGCTGGTGGGCGGTGCCGATGGCCATCGCATGGACCTGAGCGCCATGGTCATGCTCAAGGACAACCACGT
GTGGAGCCGTGGCAGCATCACCGAGGCCGTGGTGGCCGCCAAGAGTGTCGCTGGCTTTTCCCTCAAGGTCGAGGTCGAGG
TGCAGTCCGAGGCCGAGGCTCAAGAAGCCCTGCTGGCTGGTGCAGATATCGTTATGCTGGATAACTTCGAATCAGCTGGT
GCAGAGGCAGCCGCGGCTAGTCTGCGTCAGCGCTGGGCCGGGCAACCACACAGCTTCCTTATTGAGGTGTCCGGAGGCCT
GACGGCTGAGAATATCGAGACATATGCAGCAGATCGTAAGTTCTCCTGCCGCAATCTCCTGATGCCGCCTTGTCCTTGAT
CCTGCTGACATTGCAGATATCGACATTCTGTCTACCAGCTACATCCATCAGGGTGTACCTCATGTAGACCTATCACTCAA
GATCAATCAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62