GenePrediction:GLEAN_6584 Details

Name: GLEAN_6584
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:1319127..1318071 (- strand)
Length: 1057
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:1319127..1318896 (- strand)
Length: 232
Type: CDS
Source: GLEAN
Position: GCSC_156:1318813..1318071 (- strand)
Length: 743
>GLEAN_6584 class=GenePrediction position=GCSC_156:1319127..1318071 (- strand)
ATGACACCGCCGAGCAAGAGAATTCTCGTCCTGGGCGCCACCGGTGTCATTGGCAAGGTCCTGGTGGACGCACTGGTGCG
CGCGGGGGATGCCTTTGACACCATCGGTCTCTTCACGTCGCCAGACACGGTCGCCCGCAAGAAGGAGCTCATCGATTCGT
TTGTGAGCCGGGGGGTGGTCGTGCGGACCGGCGACATTGATGCTGACGAGGATGTCCTGGAGGCGTACAAAGGTGTGTCT
TGTGTTTTGTCTTTGTTCTGTGATTTCTTCTCTTCTCTGTTCTCTTCTGTCCCGGCCATCTGCTGATCAGACAGACTTTG
ACACGGTCGTGTCGGCAGTCGGCCGCAACGCCATCGAGAAGCAGGTCCGGCTGATCGACCTGGCCGCCCATCGAGCCCCG
AGCATTGTCCGCTTCTTGCCGTCCGAGTTTGGCACCGACATCGACTACTGCGCCGCCTCAGCCGCCGAGATCCCTCATCA
GAAGAAGCGCCGCGTGCGGGCCTGTCTGGCCGGACAGACCAGCCTCGCGTACTCCTTTGTCGTCACCGGGCCGTTTGCCG
ACCTCTTCATTGGCAACTTGCCGGCAGAGCCGCGCGTTGGCAGCTTCGATCTGGTCACGCGCACCGCCTTCCTCGCCGCG
CCTGACGGCCCTGTCGGCCTGACCACCATGGCCGACGTCGGTCGCGCCCTCGTGGCCGTGCTGCACCACCCGGACGTCTG
CGACGGCCGCGCCGTCTACGTACACTCCTTCGTCACCACGCCGGCCACCATTCTGGCCGAGTTTGAGCGCCAGACGGCCA
GCAGCAACGCCGCCGCCGCCTGGACTGTCCACCACACCACCCTGTCTCAGCTCCGCGACATTGAGCAGGACGCCCGCGCC
CACGCCGCCCCCCTCGCCGATCTCTTCACGCTGCGCCGCATCTGGGCCGAAGGCGGAACGCTCTACGACCACATGGACAA
CGAGGCCATCGGCCTGACCTCGACGGACTCGCTGGAGGACGTCGTGCATGCGGCTGTCGAGCGGCCGGTGGCTGCCTTCC
AGAGCGGCGAGCTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62