GenePrediction:GLEAN_6585 Details

Name: GLEAN_6585
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:1316271..1315198 (- strand)
Length: 1074
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:1316271..1315998 (- strand)
Length: 274
Type: CDS
Source: GLEAN
Position: GCSC_156:1315933..1315838 (- strand)
Length: 96
Type: CDS
Source: GLEAN
Position: GCSC_156:1315757..1315616 (- strand)
Length: 142
Type: CDS
Source: GLEAN
Position: GCSC_156:1315558..1315198 (- strand)
Length: 361
>GLEAN_6585 class=GenePrediction position=GCSC_156:1316271..1315198 (- strand)
ATGGCACCCTCTGCTACCGAACAGACCGCGTCAGCGGCCAAGGGACATGTGCAGGAGGAGCACCGCTCGGGCGACCCGTC
GTTGGCGTTTGTGCGTGACGAAGAGTCGCTGCCACCAGTGTTCACAGACAAGTACGAGGAGCGCAAGTTTCTCAAGCACC
GGCTGGCGCTGGCGTACCGGATCTTTGCGCAAAACGGCTTTGCCGACGGCGTGGCCGGACATATCACGCTGCGAGACCCT
GTGGACCCGACCAGCTTCTGGGTGAATCCATTTGGTGGGTGAAAATGATTTTGAGAAGAAGAGAAGAAGCAGAGACCAGA
GGCTGATGGAATGACCAGGCCTCCACTTTTCCTTGATCAAGGACGAGGACCTGATACGGGTCGACCACACGGGCACGGTG
GTCGAAGGTGGCAACAACCTGCGGCTCAACTACGGTGAGCCACACCATAGAGGCCATCTGAGATATACGGCCGTTGACTG
ACTGGGGGGAAAGCGGCCTATGCGATCCACGCAGAAATCCACAATGCACGGCCAGATGTGCTCTGCGCCGCACACTGCCA
CAGCATCTACGGAGGGGCAATGTGTTCGACGGGACGCACGCTGGACATGTTAACGCAGGACTTTTGCGTGTTCTACGAGG
ATCATGCGTACTACCCGTAAGTGTGATTGATTTGCCTGGGAGTTTTGGTCACTCAGCAGCTGACATGCTCCAGCAACTTT
GCCGGCCTAGTTCTGGCGACGGATGAGGGTCGAGAGATTGCAGAATGCCTCGGACCACGCAAGGCGGCGCTCCTGGGAAA
CCACGGGCTGCTGACAGCGGGCCCGACGATTGAAGCGACCATCGGCTGGTTTGTGCTGCTGGAGAAGCTGTGCAAGGTGC
AGTTGGCGGCAGACGCGTCGAGCGCAGGCTCAGGGCGGCCGCTGGTGACGATCGGCGAGGCGGAGAGCCGCAGCACGCAT
GCAGCGATTGGACATGGCGACGCAGGCTACTTTATGGGACTACCGCTATTCCAGGTGGCAGAGCGGGAATTTGGCGAGCA
GACGTATCTTGGACGAGGGCTGCGGCCGATCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62