GenePrediction:GLEAN_6586 Details

Name: GLEAN_6586
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:1312597..1311156 (- strand)
Length: 1442
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:1312597..1312459 (- strand)
Length: 139
Type: CDS
Source: GLEAN
Position: GCSC_156:1312399..1311289 (- strand)
Length: 1111
Type: CDS
Source: GLEAN
Position: GCSC_156:1311240..1311156 (- strand)
Length: 85
>GLEAN_6586 class=GenePrediction position=GCSC_156:1312597..1311156 (- strand)
ATGGGCTCCCTTCCTCCTGCGATCGAGCTGTCGGCCGAGCTGCCGGCACAGTATGCCGGGCTGCAGACGAGCAGCAAGCG
GATGAACGAGACGCTGCAGACGTCGTGTCAATGGGGCAACACGCCAGACGGCGGGATGAGTGCGTGCCATGAAGAATGGG
GGCCAGAGACGGGTGTTGGACTGACAACGAACAAACAGACCGGCTGACGGGCAACGACGACGACCGCAAGGTGCGCGAGT
GGTTCATGGCGGAGACGAAGCGATGCGGCTGCACGGTGCAGGTAGACGCGATGGGCAACATCTTTGCGGTGCGGCCTGGA
CGCAACAACGCGCTGGCGCCGATTGCGATCGGGTCGCATCTGGACACGCAGCCGACAGGCGGGCGATACGACGGGATCCT
GGGAGTGACAGCAGGCATGGAGGTGCTGCAGACGCTAGAGGCAGCCGGTGTGACGACATATGCGCCGCTGGCGGTGGTGG
ACTGGACGAACGAGGAGGGCGCGCGGTTTCCGCCGGCGATGCTGGCGTCGGGAGTATGGGCCGGGGCCTTTACGGCGGAG
TACGGACTCAGCCGGCCGGATCTGGCGGACAGCACGACAACGCTGGGCGACGAGCTGCGGCGGATCGGCTTCCAGGGCAC
GACGCCGTGCAGCTTCACGGCCACGCCGCTGTCGGCACACTTTGAGGTGCACATCGAGCAGGGACCGGTGCTGGACGAGG
CCGAAGAGGCCGTGGCCGTGGTGCAGGGCGTGCAGTCGATCCGCTGGTACCACGTCGACGTGGTCGGACGGGAGGCCCAT
ACCGGGACCACGCCGATGGACCGGCGCAGCGACGCGCTGCTGGGCGCGGCCGAGATGATCGTGGCCGTCAACGAGACCGT
CACCGGGGCCGACAACGTGCTGGCCGCGCGCCAGGCTCGTGCCACCGTCGCTGTCGTGCATGCGTCCCCCCAGAGCATCA
ACACAATTGCCGGCAAGGTCCGGCTCTCGCTCGACATCCGCGCGCCGGCCGACGCCGACGTCGAGGCCGTCGAGGCCCTC
TGTCGCGCCCGCTTCGACGCCATCGCCGCCCGCCATGGCCTCGCCCTCACCATCGACCACTTCTGGTCCTCGCCCGCCCT
CCACTTCGATCCTGTCATGGTCCAGTGCGTCCGCGCGTCCGCCCGCGCTCACGGCTGCCGCATGGAGCTCGTCAGCGGCG
CCGGTCACGACAGCTGCTACACTAGCCGCCGCTGTCCCACTGCCATGATCTTTGCGCGCTGCCGCGACGGCGTCAGCCAC
AACCCGGCTGAGTACACCCGTCCAGAAGAGTACGTCATCCCCCTCCTTTCGCGTCCCTTCTCCCGCTAACTGGACAGCTG
TGCGGCCGCGGCAGAGGTCCTTCTGGGCGCCTACCTGCGGTACGATGACTACCTGGAGAAGACGACGGAGAAGACGGTAT
GA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62