GenePrediction:GLEAN_6588 Details

Name: GLEAN_6588
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:1306173..1304568 (- strand)
Length: 1606
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:1306173..1305694 (- strand)
Length: 480
Type: CDS
Source: GLEAN
Position: GCSC_156:1305551..1304568 (- strand)
Length: 984
>GLEAN_6588 class=GenePrediction position=GCSC_156:1306173..1304568 (- strand)
ATGGAAGCCCTCAGCCAGTCGGTGCGGATGAGCCTGACGACGGCCCTGGTGGTGTCGGTATGCATCGTCGACTCGGTCAC
CATCGCCTACGACGGCTCCGTCATGGGCTCGGTCAACGTGATGAAGAGCTACCAGTCATACTTTCACCTCGACACGGCCA
CCATCTCGGTCAACTCGTGTGCCGTCTACCTGGGCGCCATCCTAGTGGCCCCCATCTCTGGCTACATCGTCAACTGGCGT
GGCCGGCGCGAGGCCATCGGCGTCAGCTGTCTCTTCAACATTGTGGGGGCCGCCATCAGCGGCGCGGCCCAGAACATCGC
CATGTTTATTGCCGGCCGCATGATCATCGGCATCGGCATGGGCCTGGCCCAGACGTCTGCCGGCGCCTACGTGTCCGAGA
CGACGGCACCCAAGGTCCGGTCGCTGGCCCTGGGACTATACTTTACCTGTTGGGCCCTGGGTGGCTTCATTGCGACGGGG
GTGTGTTATGGGGTGGGTTTTCTTTCTTTTTTCCTTCTTTTCTTGTTTCTTTCTTTCTTTCTTTTTTTCTTTTTTTTCTT
TTCTTTTTTTTTTCCTCTTTCCACCTCTTTCCACCTCTTTCCTCTTTCCTCTAACTCAATAGACACAACAAATGGACCCG
TCCGACTGGGCTTGGCGCATCCCCTGCATCGTCCAGGCCTTTGCCCCCGTCTGCGTGCTCGGCATCCTGCCCTTCTTGCC
CGAGTCGCCGCGCTGGCTGATCTACAACGACCGCAACGAGGAGGGTCTGGCGGTGCTGGCGCGCATCAACGGCGCCTTGG
CCGACGACACGGCCGTGCAGCTGCAGTACCAGGAGGTGCTCGACACGATGACGTACGAGAAGACTGAGGGTCGCAGCCTG
GGCTTCCGCGAGATTGTCCGCAGCCCAGCCAACCGGAAGCGGCTCGGGCTGGCGCTCTCGGTGGCGCCGCTGACGATGCT
GACCGGCTCCAACGTGATCACGTACTACTACGGCACGATGTTGGACCAGGCCGGCATCACCTCGTCCAAGACGCAGATGG
AGGTCAACCTGGTCTTGTCGGCCTGGCAGTTTGTCATCGCTGTGCTCGGCTCGCTGCTGGCCGAGCGTCTTGGCCGTCGG
TTTCTCTGTCTCGCGTCGCTCGCCACCTGCACCGCCTTTCTGTACGGCCTCGGCGGCATGACGGCCACATACGGCGGCTC
GAGCAGCACCTCGGGCATCTACGGCACCGTCGCCTTCATGTTCTTCTTCCTCGGCTGCTACTCGTTCGGCCTGACGCCCC
TGACAAACATGTATCCACCCGAGGTCCTGTCGTACAACCTGCGTGCCACCGGCATGGCCATGTTCACGCTCTGCGCCAAG
GCCTGCGGCGTCTTCGTCACCATGGTCTTTCCCTACATGTTCAGCGCCATCGGCTGGAAGACGTACATTGTCAACGCCAG
CTGGAACGTCCTCTTCCTCGTCTGGGTCTACTTCTTCTGGGTCGAGACTCGCGACAAGAACCTCGAGGAGATTGACGAGC
TCTTTGACGGCATCCGCCACTCTGACGTGCCCACCCTCAAGCAGATGCGTGAGAAGACTGCTGCCGTCAGCGTGGTTGAG
GTATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62