GenePrediction:GLEAN_6591 Details

Name: GLEAN_6591
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:1289915..1287649 (- strand)
Length: 2267
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:1289915..1289809 (- strand)
Length: 107
Type: CDS
Source: GLEAN
Position: GCSC_156:1289744..1289573 (- strand)
Length: 172
Type: CDS
Source: GLEAN
Position: GCSC_156:1289524..1289470 (- strand)
Length: 55
Type: CDS
Source: GLEAN
Position: GCSC_156:1289033..1288988 (- strand)
Length: 46
Type: CDS
Source: GLEAN
Position: GCSC_156:1288937..1288091 (- strand)
Length: 847
Type: CDS
Source: GLEAN
Position: GCSC_156:1288029..1287649 (- strand)
Length: 381
>GLEAN_6591 class=GenePrediction position=GCSC_156:1289915..1287649 (- strand)
ATGTCCATGTTCCGGCCCAAGAAGCTTGATCTGGGTTGCTACGTCAACATCCGCGTCATTCGCGACCATGCGAAGCGCCT
GGCCTTTGAGAGCTTCGAGGCTGAGAGGTATGCGAGAGTGGTGAGCGGAGGGGAAGACAAGCTACTGACTTTGCGCCTTC
CCGCTGCGCAGACAGGCTTTGAGACACGTCATCCGCAACACGACGCTGCCGGCCCGCACGCGCGCCGAGGCCCAGCTGCA
GCTGACGCAACTGCCGGCATACTCACGCCCAAGCCAGATCCGGAACCGCTGCATTCTCGGAGGAAAGACCCGGGGTATCC
TGCGGGACTTTAAGCTGTCACGGGTGAGTTCTTGTCATTGCGCTTGCTTGGCTGTTTCGCTGACCCGTCAGTATAACTTC
CGAATCCAGGCACTGAGTGGAGGAATCCCCGGCGTGCGGAAGGCTAGTTGGTAAAGGTGGAAACGCTTTGTGTACGATAA
GGTTGAGGCGATACAACTCACGAACCCGGCGTCAGTGACGTGGAGGAATGCAGTCTCGATCACCTTCTCGTTGCTAGAGT
CAGGTTCAGAATAACGTAACGAAATGATGAACCATGCGACGTAGACCCATCTACTCTGGACAAATTCCATAGTCACTGAT
TCACGCTGGCTCTGACAAACTTTTCACTGTCGTCTGTTTTGGCAGTGGACTACACAAAGCGTGGAAGGACCGATTGCACT
TGCTCCTTCCTGGTCTGTCATGTCTGCTCTCACCTCGACTCTCACTTAGTTCGTGCATTACTTGAAGAGAAAACGCTTCT
TGTCCATCCAACTCAAAACGCCAACCTCAACCAGTCGTGTCTTGTGTTGTACCGACTAAAATGTTCCGTCGCTTGTGGAC
AGGCCTGCCGGAGGACTCGTCCTTCCCTGAGGACCTGGAGAAGCTAGGGTGAGTAGAATGACGATAGCTTTCATCTTCGA
GCCCAGACTGACGACCAGCTACTATGTGAACGAGGATGATGAGATCCGCAACATCCAGGATCCTAGGTTTTACTTCAAAT
ACTTTATCAACAGGAATATGTATTACAACGATCGGCAGCGCTTTGCCTTTGGCTGTACGTGCTCGTCGAGCTTCTTCTTC
TTCCGCTCCTTCTTCTGCTCTGACACATGGCTCCGACCAGCTGCCACCAACAGCCTCGTGTATGACCGCCTGGCCAAGCT
CGGCCTCCGACCTGTCCGGCTGCCGCTGGGCGCTGCTGCCGACGAGCCCCACGTGACGGTACTCGCCACCGACGACCTGG
CGACAGCCGGCCGCATCGTCCTGTTTGTCGGCGAGACGGTGCAAGACATTGGGATTCTGGCCCGTCGCATCGTCGGTGGT
GCGGGTGGTATCAACAAAGGCAGCCTAGTGTCGATGGTGGAAGCTGTTCGCAAGGAGCAGACAGAGCATCGTGCTCCAGC
CATACTCGTCTTCAACCCCGGCCAGCTCTTCTGGTGGCCCCAAGGCGGCCGTGCTCTCAGCCTGCCGGCACGCCAGGGCA
TGCCGCGACCGAGTGCGGCACACTACCCTCCCCGGACGCTTCCCGGGATCAACAGCGTTCCGGGACATGCCACGGCCGAC
GAGCACGTTGCGAGCGTGTTCCGCGATCTTCTCGCGCCGCTGCTGCCTCCGCCCCGTCTCACCGTCATCGCGATTGCAGG
CGGTGCTGACGCGCTGGAGGGATTTCTGGACCAGGCCGACAACTGGCGTCGCTGGGGTCCACACATGGATAGCCTTGCTC
TCCTTGGCGGCCTGTACGAGGCAACCGACGTCAAGACAAATGGCTTCCGGCAGTTTTTACGCAAGGTCAGATTTGGATTT
ACTATTTTTTTTCCTTGTTGTCTGTATGACCTGCTGACAGCTGCAGCGGGCCCGAGCCTACATCCCAAGCACGGCTCCGG
TCGACATGCCGATTTCCGGGCCAGACGGCAACGACCAGACCATGCGGTCGACGCGCTTTGGCTGTCCGGTGCACAGCTCG
GGCACGTCGTGGCTGACGGAGCTCATGTTCATCGACGCCCAGGACGCGATTCTAGCGTGGGGCAGGGCTGTGGCAGACAA
CCCGGGATATGAGAACGCGCAGATGGAGATTACGTATGCCGAGGAAGCGATGGCCGAGGTGGAGAACACATGGGTTGGCT
ATGAAGGCGGCGTGGACCAGACAGCGGCTGCTGATGACGTCGAGAAAACGGCTGACAAGCTGTCGGTGGAGGACAGCAGC
ACAGATGGGTCAAGTGTGCACGTATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62