GenePrediction:GLEAN_6592 Details

Name: GLEAN_6592
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:1285137..1284223 (- strand)
Length: 915
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:1285137..1284943 (- strand)
Length: 195
Type: CDS
Source: GLEAN
Position: GCSC_156:1284875..1284846 (- strand)
Length: 30
Type: CDS
Source: GLEAN
Position: GCSC_156:1284778..1284378 (- strand)
Length: 401
Type: CDS
Source: GLEAN
Position: GCSC_156:1284322..1284223 (- strand)
Length: 100
>GLEAN_6592 class=GenePrediction position=GCSC_156:1285137..1284223 (- strand)
ATGGTTTCCCGCGCTGCCCCGCTCGTCTTCCCGGCCACGGCACGCCACACGGCGACGGTGATCTTTGCCCACGGACTGGG
CGACTCCGGCCACGGCTGGGCTGCTGCTGTCGAGAACTGGAGGCGTCGCCAGCGGCTGGAGGAGGTCAAGTTTGTGCTGC
CGCACGCGCCCAACATTCCGATCACGGTGAACGGGGTATGTGATGCTGGGACTGGGATGTCTAGACTCCTGACGGTTGTC
TGACAATTCGCTGATCTTCTAGGGCATGCGCATGCCGGGATGGTATGACATTGTAGGTTGATCTAGGTCCTGTTGACGTT
GACCTCTCCTCCTTCTCTCCCCCCTCTCACATCGCCCAGGTTTCCTTCGACAGCCCGGGCACCAGCCTGCGCGACAACGA
GGACGAGGCCGGCCTCGTCGCCTCACGCGCCTACTTCCACCAGCTGGTCCAGCAGGAGATCGATGCCGGTGTGCCGGCCG
AACGCATCGTCCTCGGCGGCTTCTCGCAGGGCGGCGCCATGGCCATCTTTGCCGGCATCACGAACCCGCGGCGGCTGGCC
GGGATCGTGGCCATGTCCACGTACCTGGTGCTCTCGCAAAAGATCGAGTCGAAGTACCTTCCTAGCCCCAACGCCAACGC
CTACACGCCCGTCCTCTGGTGCCACGGCACTGCCGACCCGGTCCTGCCCTACAAGATGGGTGAGCTGTCACGTGACGCCC
TGCGCCGCATGGGCTATCCTGTCGAGTGGAAGTCGTATCCGTGAGTGTGCGCCAAGAGAATAAAGACAGACAGGACCGTC
ACTAACTAGACATAGCGGCATGGCCCATTCTGCCCTCCCCGAGGAGCTGGACGACGTCGAGTCCTTCCTGTTCCAGGTCT
TGCCGCCACAGGCAGGAGGAAAACAGGAGCTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62