GenePrediction:GLEAN_6593 Details

Name: GLEAN_6593
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:1274493..1273072 (- strand)
Length: 1422
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:1274493..1274241 (- strand)
Length: 253
Type: CDS
Source: GLEAN
Position: GCSC_156:1274161..1273456 (- strand)
Length: 706
Type: CDS
Source: GLEAN
Position: GCSC_156:1273399..1273072 (- strand)
Length: 328
>GLEAN_6593 class=GenePrediction position=GCSC_156:1274493..1273072 (- strand)
ATGGCCATGACCGCGATCCACGCTGTGCCGGCGAATACGGGCGGCGGTGGCAGCAGCAACGGGGGCCTGTGGACGCCGCC
TGCCGGGTTCAAGAGTGCCCGGACGTCGACGGCAGGCATGGTGGTCGGCAGCATACCAATAGGAACAGGAAGCAGCAATG
GCTGTACAGCCGACTCTAAGAGGGACGCGAGCGGCCCGTTGGGGTCAGGAAAACATCCGGCCGACTATGTGCGCATACGC
ACGCTCGGAACAGGTGGGTTCAAGGAGGAAGAAGGGGAGGAGAGGAGAAGAGAAGAAGAGAGTGCGAAGGAAGAAAGTCG
CTGACCTTGCAGGCACTTTTGCTCGCGTCTGCCTGGTCCGACGAGCGCATCCACGCGACGATGCCGAGGCACAGCAGGTG
TTTGCGCTCAAGATGCTGCGCAAGACGGCGGTGATCAAGCTGAAACAGATCGACCACGTGCGACACGAGCGGCAGATCCT
GCAGGACGTGGCGGGCCACCCGTTCATCACGACGCTGCAGGCCTCCTTTTCGGACCACGACTTTCTATACCTGCTGCTAG
ACTACGTTCCCGGTGGCGAGCTGTTCAGCTATCTGCGCAAGTTCCGCCGCTTCGACGAGGCGACGGCGCGCTTCTACGCG
GCCGAGATCGTGCTGGTGCTGGAGTACCTGCACGAGCAGCAGGACGGAGTGGCGTACCGCGACCTGAAGCCCGAGAACCT
GCTGCTGGACGCGGCTGGCCACGTCAAGCTGGTGGACTTTGGCTTTGCCAAGCGGCTGGGCGGTGGCCGTCTGCACCAGC
AGAAGAAGCAGGCAGCTGCTTCGGGCGATGTTCCGATGGAGGACGCCATAGCAACAGCCGATCCGGCCATCGAGACGTAC
ACCCTGTGCGGCACGCCCGAGTATATCGCGCCCGAGGTGATCCAGAACATGGGCCACACGACAGCCGTCGACTGGTGGGC
ATTGGGCATCCTGGTGTACGAGTTCTTGACGGGCTATCCGCCGTTCTGGCATCAGAATCCGCTGGAGATCTACCGACAGT
ACGTTTCCTCTCTTTCGCTGTACTCTTTCCAGTGTTCTTCTAACTCCCCCCCAGAATCCTGGAAAAACCGGTCGTGTTCC
CCCACGACCCCGTCATCTCGCCGGCAGCCCAGGATATTGTGCGCCAGCTGTGCACGGTAGACCGGTCGCTGCGGCTGGGC
AACATCAGTGGTGGTGCGGCGCAGGTGCGGGCACACCCGTTCTTTGCCGGCGTCGACTGGGACGCGCTATACGAGCGACG
ACAGGAGGGCCCGATCCAGCCGCGGGTGCGGTTCAATGGAGACGCACAGTGCTTTGACATATATCCGGAAAACGACGTCG
ACTTTGAGCCATACACGGACGACATGGCGGCACAGTACGACAAGTTCTTTATCGACTTTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62