GenePrediction:GLEAN_6594 Details

Name: GLEAN_6594
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:1259540..1257988 (- strand)
Length: 1553
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:1259540..1259486 (- strand)
Length: 55
Type: CDS
Source: GLEAN
Position: GCSC_156:1259274..1258844 (- strand)
Length: 431
Type: CDS
Source: GLEAN
Position: GCSC_156:1258716..1257988 (- strand)
Length: 729
>GLEAN_6594 class=GenePrediction position=GCSC_156:1259540..1257988 (- strand)
ATGCCGTCACAGGCCAACGACGGAAATTCCAAGTTTATGGCCGACATCTTTGTACGTCCCATCTACGATACCACCATTGC
CCACCCCTTTTGACTTTTGGCGGGTTGTCAATGAAACGCTCTCTGTTTTTTGACGCATTCCCTTTGACATGTCGACGCAT
ACGTGCTCTTGTATTTTTGCGTGCATTTATACTAATCTATGCAGAGCTCTCTCAGTATGGAGGACAAGACCAGTTCTGCC
ACAAAGTCCGTTGCTCCGGCTCCCAGTAACGCCCAGCCCCGGCGCTCAATGGACGACCGTGGACCGCCCCCGGCGGGACG
AGGTCGCCCTGCTGTTGGGCCACCGCCCCGTGCTAAAAACATTCCGCCGCGGCGGTCACCCTCCCCCAATAGCCGATCAG
CTCGGTCTCAAGAGGACGCTTCGAAACGGCACCACCCAAGCAGCAGTGCTGTCTCTGGGCGGACTGGCCAACAAGGCCCT
GCCCCAGATAGGTCTGCAGGCCGTCGCCCATCCGTTTCTCGGCCTCGGCGCAACTCTGAGTCTTCTGTGGCGGACGATAC
CAACCCGTCCAAGAGTGACAAAATCCTTCGAGAGGCTCGGCGTCGTGAGCAGGCGAGTCGGGAGAAGAGCTCAACACGCC
CAAACCGCCGCAATGATATTATTGATCAGCTGGATGCCACTAGCATTTTTGGAAATGGTATGTAGAGTTCCTGCATCAAC
TCGTGTATATTCTGGCCTAACGCGTTTTAGTTTTCCACCATGATGGTCCTTTTGATGCTTTGAATCCACACCGGAACAGA
CACAACCGTCGTGCCCCTATGCAGGCGTTCCCGAAGGACTCATTGAACAACATTCTTGGCGGTTCGGGTCCTCTGAACAC
GCGGCCTGACCACAAGACCTTCATGGGCCAGGGCGAAGACGAAGCGTTCAGAGACTTCGCTGCCAGCCGTGAGAAGACCA
GCTCGTCTGCCAATGCGACAGTTTTTGACCCTCGCCGCGCTTCCATCGTTCATGGAGACGAGTCTCTCGGCTTGGGCACT
TCAACATTCTTGGAGGGCACGCCTGTTGCTCGCACCACAATCCAGCGCCGCGAAGCCGAAAGGGCTCAAGATACGCAAGA
TAATCCGCTGCAGCGGAAGAAGTCGCTTGCGCAGCGCTTCCGCAGCACCAAGCGCGGACCTCGTGAGGGCAATGCTGGCC
GCGCCTTCAGCACAGATGGAACTCCTATTGCGTCTCGCCCCCGCGGTAATGGCAACGAGCGTCCAGGTCGCCAATTTGAG
GAGTATGACGGGTCCAGAAATGAAGAGGATATGATTAGCGTCCGTAGGAAGGCTCCGCCTATGCCGGGCTCTCCTCCAAG
CCCTCGCGACGATTTTGAGCGGCGGTCTACTTCAGATGCGGCCTATTCGATGACTGACGCTCCAAAGCACAGCCATTCTG
CGACTGGATCTGATGATGTTTCGAAACCGACCAGCAGCGGCCTTCTGGCTCGCGTAAAGAGTTTGAAGGGGGGTCGTCGG
GCACCTCCACCTCCTCCTACGAGGGACTCCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62