GenePrediction:GLEAN_6597 Details

Name: GLEAN_6597
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:1237225..1236527 (- strand)
Length: 699
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:1237225..1237072 (- strand)
Length: 154
Type: CDS
Source: GLEAN
Position: GCSC_156:1236995..1236711 (- strand)
Length: 285
Type: CDS
Source: GLEAN
Position: GCSC_156:1236591..1236527 (- strand)
Length: 65
>GLEAN_6597 class=GenePrediction position=GCSC_156:1237225..1236527 (- strand)
ATGGCCGGGCCGCAGGTGTCTGAAATGGCTGACAGCGGGCACGAACAAGAGCCTGAAGGCTGCTATGTCGATCTGGCGGA
GGGTCCGCTGGACGTCAATGCCGTTCTCGCCCGTGTCCGCAGCCCCAAAGCTGGAGCGAATGTGTTGTTTTCAGGTAAGT
TTAGCAGGCATGGCAGCCAAAAGGCACGAGAAAGACTCGCCAAAGAAAGACGCAAAACTGACCACGCCAGGTTCGACTCG
AGACAACTTCCAGGGCCGCGCAGTCGCCACCCTGTGCTATTCCGCCTACCGGCCGCGGGCTCTGCGGTCGATGCGCGAGA
TTGCTGCTGACATTCGCACACGCCATGGACTGCTGTCCGTGGCCATTGTGCATCGGCTGGGCCCTGTGCCGATTGGCGAG
GACAGCGTGCTGATCGCCGTGTCAGCACCGCACCGGAAGGCAGCGTGGCAGGCGGGCGAGGAGTGTCTGGAGCGAGTCAA
GGAGCGGGTGGAGATCTGGAAGCAAGAAGTCTTCCGTGCTGTGGCCGAAGTCGCAGAGGGCAAGGGCAAGCGAGAGGGCG
AGGACGAGGACGAGGACGAGGACGAGAACAAGAAGGAGAAGGCGGGGGCTGAGCGAGTCTGGCGCGCCAACAAGGCCTGA
CGGGCGACCGGATGTACACTGTGGCACCAGTATCGCTGTCAAACGGCGTCGATGACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62