GenePrediction:GLEAN_6599 Details

Name: GLEAN_6599
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:1232232..1231271 (- strand)
Length: 962
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:1232232..1232198 (- strand)
Length: 35
Type: CDS
Source: GLEAN
Position: GCSC_156:1232032..1231833 (- strand)
Length: 200
Type: CDS
Source: GLEAN
Position: GCSC_156:1231724..1231632 (- strand)
Length: 93
Type: CDS
Source: GLEAN
Position: GCSC_156:1231410..1231271 (- strand)
Length: 140
>GLEAN_6599 class=GenePrediction position=GCSC_156:1232232..1231271 (- strand)
ATGGAATTCCAGATGGGACTGCAGATGGGTCTGCCGTAATACGAGTACGCCGTACGGAGTATTGACTAGGGGTTTGGAAG
GGGATGAGCTGGTGGGAGCATTCCGGGGTCCTGGATTCGAGCAGCACGAACGCCGCAGGGGTGCTGGCCATGGAAGGAGA
GGACACAAACACCATACGAGCAGTCCGCCGTACTCCGTAGGGCTCTGTGCCGGTCGGACCCATGGGCCGAAGTCTTGGAC
GTCGATGCGGCTCGAAATGTTACAGAAGAGCAGTTTCAGGTGGCCGTTCGCCGTGGAGGGTCCAGGCGGAGATTACAGGG
CTCTCCAGTGCATCTGATTGGCCTGCGGGCGTCTGTTGGGGAATCTAGCGCAGCGGCAGGCGGCGCTAGCAGCCTAAAGA
GTAAGCTTCAGGCCGTTTGAGTTTCGCACCGAATAAGCGACGGTGGGCACCTGCTATTATGCAGCTTGCATGCTCTCTCT
GTCCTCTGTCCTCCATACACAATCGTAGCGCGGCAATCGCGAGGAGACCGCAGCCAATTGATTCTGACCGGCGGCTACAG
CAGCGTGGTGAACACTGCCGCGGATCTCCTCAACAAGCGTTGTAAGCATATATGTCGTGCGGCCCGGCTGTCCGACAGCA
TGGTGAAACGTCCCGTCCTCGCTCGTCTTCCATTCCCATCATCGCGGCAGCATCTGTGCGCAAGGGAAGCATTCATTACA
TATACTTCGATAGGAGAGGCGATTTGGCCTGTGACCCCTGAAACCCGGGTGGAGACGCTACTGTTACAACTTTAATGCCA
CCTGTAACCTTGTTATTCCCAGCGGCGGAATACGAGATTTACAGATCAACGCAGCAGCTGGCCGTCTCGGCCAAGAAGCC
TTCATCCCAACCTGACATATTCTTGCGCCGGGCCTCGGCCGATTCTTGGGCGATCAACATTCTGGGTTTCAAGGCCCTGT
AA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62