GenePrediction:GLEAN_65 Details

Name: GLEAN_65
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:428438..429943 (+ strand)
Length: 1506
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:428438..429047 (+ strand)
Length: 610
Type: CDS
Source: GLEAN
Position: GCSC_179:429126..429943 (+ strand)
Length: 818
>GLEAN_65 class=GenePrediction position=GCSC_179:428438..429943 (+ strand)
ATGGCGGCAGTAAGCGGCACGCGGCGGCTGGTGAGCCTGCAGCCGGTGTTGGGATGGAGGGGTGTTGGCCTGGGGGCAGC
AGCGGCCTCGTCGGCAGTCCGACCGCTCTCGACGACGGCGGCCTGTGGTGGTCCCAAGGGTGCGGCCCACGTGCGGGGCA
ACAAGCAGGTGCAGATGCGCAAGAAGAAAAAGGCGCCGCCGCGCGGCAAGACGGCCGAACCGGGCGAGCGCAAGCAGCTG
CGACGACGGATTGTGCTGAGCAACGGCAACGCGCTGGCGGTGACAGGCCTGGAGGAGCTGACGGCCAGCAGGCTGCACGA
CAGCGACAGCGTCGGACGCGTGCTCGCGCTGCCCGACGGCGTGGTCGACCAGCTGCGGGCGGTGGGCGCGTTCAAGCCGT
CGCAGAGCTTCTCGCTCTTCCGGCGGCCAAGCGTGCTGATCCGTGCCGAGACGGCCACCGTGGCCGCCCAAATGCAGCAG
GCTGCCGCGGCCCGACAGACACTCCGACTCGTCGTCGACGGGGATCGCATCGCCGGCAAGTCCATCCTGCTGCTGCAGGC
GCTGGCGCACGGATTCATGAACGACTGGGTGGTCTTTCACATTCCAGAGGGTGTGTTCTTCCTCTGTCTTCCACCTGTTT
CCCGTTTTCGTCATCGTCCTCCGTCCTCTGTCCTCTAACACACCACAGCTCATGAACTCACCTCGGCGAGCACCGACTAC
GCCCCCCTCGACCCCCTCGACGGCCAGCCGCCCCGCTTCGTCCAGCCGGCCTACATGCTGCAGCTGCTGCAGGCCGTCCA
GGCTGCCAGCGGGCCTGTGCTCGCCCGCCACAAGACCGTCCGCGCCTACGACCGGCTCCAGAATCCGGTCGCGGCTGGCA
GCACGCTGCTGCAGCTCGTCGCCGCCGCCCGTGAGAACGACCATGCCTGGCCCGTCTTCCAGGCCCTCTGGTCCGAGCTG
ACGACGACGGAGCCGACCGAGATCGCCCGCCCGCCCGTCCTCTTCGCCCTCGATGGCCTCGCCCACGTCATGGGCTATAG
TCGCTACCGCGACCCTGCTTTCGAGCAGGTCCACGCCCACGACCTTGCCCTCGTTCGCGCCTTTGTCGACCTCCTTGCCG
GCGCCGAACTGCTGCCCCATGGCGGTGCTGTCATCGCTGCTACCTCCCGCGGCAACGCGCCCGCCTGTCTGACCCTCGAT
CTCGCCCTCGCCCGCCGCCTGGCCGAGCAGGACCAGACGGACGCGGCCACCAACACCTCCCTCACCCCTCCACCCTACTT
CCGCGGCTTCGACGACCGCGTCGCCGCTGCCCTCCACTCTGTACGTGTCCTCCGCCTCTGCGGCCTCTCCCGCCCCGAGG
CTCGCTCTCTCATGGAGTACTGGGCCGCCAGCGGTGTCCTCCGCGATCGTGTCGACGAACAGGCTGTTGCCGGCACTTGG
TCCCTCGCCGGCAACGGCCTCGTCGGCGAGATGGAACGCACCGCCTTGTTGAGCTTACGGCCGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62