GenePrediction:GLEAN_6600 Details

Name: GLEAN_6600
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:1229276..1228006 (- strand)
Length: 1271
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:1229276..1228839 (- strand)
Length: 438
Type: CDS
Source: GLEAN
Position: GCSC_156:1228703..1228322 (- strand)
Length: 382
Type: CDS
Source: GLEAN
Position: GCSC_156:1228259..1228006 (- strand)
Length: 254
>GLEAN_6600 class=GenePrediction position=GCSC_156:1229276..1228006 (- strand)
ATGGTGGCTCTGCGCCCATCGTTCACGGCCGCTGTGGCTTTCCGGTCAGTCGCAGCCGCAGCTGGGGCAGCAATGCAGAT
GAGCGAGCTGTCATCAACGCTGCCGCCGCTTCGAGACTCGCTGTCGGGCATCTTTGGCAGCGTGAGCCTGACGGCGTGGA
TTTGCCTGCTGCTGCCACAGCTGATTCAGAACTACAAGGCCCAGAGTGCCGAGGGCCTGTCGATGGCCTTTCTCTTTGTC
TGGCTGCTGGGCGACATCACAAACCTGTTTGGCGCTCTCTGGACGGGGCTGGCCCCAACGGCTGTGGCCCTGGCCACATA
CTTTTGCTTTGCCGACCTGGTGCTCATCGGCCAGTGCGTCTACTACAACACGCTGAACGCGCGTCGGGCGAGCCAACACG
CACACGTTCACCGTCGTCGCCGCAGCTCGGCCACGGCCGTGGGTGACGGTGCTGACGCGGACGATGAGGGCGGCGACGAG
GACGACGAGGAGCTCGAGGCCGAGGACGACGCCGGCCACCGCGCGCATCTGGGCGTTGATGCTGCCGACAATGACGACGA
TGAGGACGAGCAGGGCCCTCTGCTTTCGCGTCGTCGTAGCTCCAGCATCGGGCTGCCCGGCTCGCATCGCCGCCACTCGG
CCAGACGCAGCGAGTCCAACCTCGATCCGCTGCGTTGCATCATCACCGGCGAGGACGAGACGCCCGACACGAACCCGTGG
GTGCACAACGCCCTCAGCCTGGTGGCTGTCTTTGCTGTCGGCACGGTCGGATACTTTGCTTCCTACCGCATGGGCGCCTG
GGACACCGACCCCGAGGACGACGGCCTGTCCTCGTCGGATCCCGAGAATGTCTACGCTCGGATTGGCATGGTGCTGGGCT
ACTTTAGCGCCGTATGCTATTTGTGTGCCCGCATCCCCCAGATCTTCAAGAACTACCGGGAGAAGTCGTGCGAGGGTGAG
TTGCTGTGTTCTCTTGTCTGCTTTGTTGAATTATGAGAAATGCTGACTAATCAACAGGCCTCGCCTTGCTTTTTTTCCTG
CTGTCGCTGACGGGCAACCTCACCTACGGCGCCAGCCTGGTGTCATATTCCCAGGACCGCGATTACCTCATCAAAGCGCT
GCCGTGGCTGCTGGGCTCGCTCGGTACAGTGGTGGAAGACGGCATCATTTTCATGCAGTTCCGCCTCTACACGCCAAAGC
GTCACGTGGACAAGGCTGTCAGCAACGAGACCATCCGCAGCGGCACTGTCGGCACATATGGCGCTGTATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62