GenePrediction:GLEAN_6601 Details

Name: GLEAN_6601
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:1219037..1217414 (- strand)
Length: 1624
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:1219037..1218702 (- strand)
Length: 336
Type: CDS
Source: GLEAN
Position: GCSC_156:1218607..1217414 (- strand)
Length: 1194
>GLEAN_6601 class=GenePrediction position=GCSC_156:1219037..1217414 (- strand)
ATGCTCGCCGAAGACTTTTTCACGGCCGTCAACGGCCCACCGCTGGCCAGCAACACGGCCATAGCCAAGGACGTGGCGGT
CTACCACCAGACGCTCAGCCCGAGTTACGGCGTGCGGACAACGTTTCGGAAGAGCGCAACACCGGTGGGCGGTCTCGCCG
TCAGTCCTGCACACATCTTTGCGGCCCAGCAAGACCGCGCGTATCTGCACGTGTATTCACGGCTGCGCGGAGGCCAGGAG
GCGGCGGTACCGATGCCCGAGAAGATTCGGTGTCTGGCCCTCGCTGGTGACGTTCTCATTGCTGGAACTGCTGAAGGACG
ACTGCTCCTCTGGGAGGTGTGTTTTTTTTCTTTCTTCTGTTTTTGCCTCGCTTCGCTCGATATCTTCTCCTAGCTCGGTC
TTGTCGTTTCCCTCGATCTAATACGTCTAGACTCTCTCTGGCCGTCTCATCACAACTCCTCCCTGCCACGTCCAGGCCGT
CTCCTGCCTCCAGACGACGTCCCACCACGTGCTCTCTGGCTCGGATGACTCCAACGTGCACGTCTGGTCTCTCTCGCAGC
TGCTAGCTCTAGGTGGCGCTGGGGGTGCGTCTTCCAACGGGACGTCCAGCTCCGACGACCCAGAGCCCGAGCACACGCTG
GCCCGCCATCGGGCTGCCGTGACTGCGCTCGTGGTTGGGTCTTCAGCCAGCCGTGACACCAGTCTCTGTGCGTCTGCCAG
CCGTGACAAGACGGTTGTGCTGTGGAACTACCAGACCGGCGTGGCTCTGCGCACGCTCCTCTTTGCGGCCGTGCCCACGT
GTCTGGCCCTGGATCCCGTTGCTCGTGCGTTGTACGTTGCCACCGACGACAGCACCATTAGCAGCGCTGCTGCTGCTGCC
AGCTCTGCCAATACGGCTGTTACGGCCGCTACGGCCGGCCACATCTTTGCACTCGAGCTCTTTGGCGACAAGCCGCTGCT
GGGCGCTCGCGGCGCCGAGGCTGCATCGACGGCTGCGTCCATCACAAAGTCCTTCGGTGCTGTGCCTGAAGAGGCCGGCC
CGGCCAACTGCCTCTCCTTGAGCTACGACGGAGCCACTTTGCTGTCGGGCCACCCGCGCGGTCGCCTATTGCAGTGGAAC
CTCGGCGATGGCGCCAGCAGCAATGGCGCCGGCTCCACGGCTCTCCCGGTTGAGCTGGCCAACCTCAACGCGGCCATTAC
GAATGTGGTGTTTGTGGCGCCTGCAGCCCTGACGGCACGCGTGGTGCCCCGCAAACTGATCTCTGCGCAGACGGTGGTCA
AGCCGTCCCAGGCTGGCCGGTCGTATTCTGTGGCGGTCAAGTTTGACGAGGAGCCGTCGACGGATTTTGACGCGCTTCTG
CACGAGCCGGGCTTCCCGGGGCAGAGTCTGCAAAAGGCAATTATGGCGCTACAGCAGTCCGAATCGCAGGAACAGGTGCA
GGAACAGATGCAGGAACAGCCAGAGCCGGCAAGCGAAGCTGCTTCTAGCGAAGCCGGTGACGCTGCGGGTGACTCAAAGC
TCCGGCGACAGAACGCAGAGCTTCTGGAGATCATCAACGAGCAGCAGGCGCTCTACCAGCAGGCGCTGCAGCGGTGCGCG
GACCTGGAAGCAGCACGGTCTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62