GenePrediction:GLEAN_6602 Details

Name: GLEAN_6602
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:1216402..1214390 (- strand)
Length: 2013
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:1216402..1214390 (- strand)
Length: 2013
>GLEAN_6602 class=GenePrediction position=GCSC_156:1216402..1214390 (- strand)
ATGCGCTTTGCCACACCCTCTGCTCTGGTTGGGCTGCTGGCTGCCCTGGCGGCAGTCGTCGACGCCTCGCCCACAATGCA
GCAACGGCAGCGGCAGACGCCTGCACGACGATCACGACACGTGCTGCACGAGCGGCGGTCGGAAGGAGCGAGCAATCTGT
GGGCACGGACGGCCAAGGCAGACCCGGCGGCGGTACTGCCGGTACGGATCGGGCTGAAACAGCAGAACCTGGAGCGCGGC
GAGGAGTTTTTGCTGGATGTGTCGCACCCGACGTCGGCCAACTACGGACGACACTGGACGGCAGAGCAGGTGGCGAAGAT
GTTTGCGCCACGGCCGGAAACGGTGGACGCGGTTCTAGACTGGCTGGCAGACACAGTCGGCATCGGCGAGGCGAGCAGCC
GGCGCGTGGAGCTGTCACGGGGACGCAACTGGGTGATGTTCAACGCAACGGTGGAGGAGGTGGAGCGACTGCTGGCGACG
GAGTACCACGTGTACCGGCACACGAAGCACGGCCACGAACAGGTGGCCTGCGACCAGTACCACGTGCCGGAGCACTTGCG
CGAGCACATCGACCTGGTGCTGCCGACGGTGCACTTTGGGAGATCAGGACCGGGTGGACGGTCGGGCAAGACGCATCAGC
TGCCGGAAGACGTGCAGACGCAGCTGAGAAAGCGAGAGGGCTCGGGGGAGCACAGCTTGCCGGGCCAGCCATCAGACGCA
TCGCTGGCCAAGCAGGGAGCCGTTATCACCAACGCGCTGATGAGCCTCGACCAGTGCGACTCGATGATCACGCCGGCCTG
TTTGCGAGCGCTATATGCGGCGCCGGTCAGCAGGCTGGCGGCAGCTAACAACAGCATCGGCATTGTTGAGTACACGCCAC
AGGCGATCTTGCAGAGCGACCTGGACCAGTACTTTTCGCAGTTTGCGCCACAGCTGACACGCGGCTCGGCTGCCCGGCCG
GTGGTCCGGCTGATCGACAACGCCGTTCTGCAGACGGACAACGAGAGCTTCAGCTTCAACGGCGAGTCGGCGCTGGACCT
CGAATTCGCCATGACGCTGGTGGCCCCACAGACAGCCACGCTCTTTCAGGTCGGCGACCTGCAGCAGGGCGCCAGCTTCA
ACAACCTGCTCGACTCGCTCGACGGCAGCTACTGCACCTTTGAGGGCGGCGGCAGCTCCGATTCCAGCATCGACGGCCAG
TACGACAACAGCGTCAACTGTGGCACGGCCACGCCGACAAACGTGCTCTCGACCAGCTACTCCTACAACGAGGCCGATCT
GACGGCTGCCTATGAGCAGCGCCAGTGCGCCGAGTACATGAAGCTGGGCCTGCGCGGCGTCTCTGTGCTCTATTCGTCCG
GCGACTACGGCGTGGCCGGAAACAGCGGCCAGTGCATCGACGCCACCACCGGCGTCTACAACGACGGCACCGACGGCCTC
TTCACTCCCTCCTTTCCCGGCACCTGTCCTTACGTCACATCGGTCGGCGCCACGCAGCTGCCGGTCGGCTCTTCCGTTCC
CGGTCCCGAGATTGCTTGCCAGAAGGTCATCTACTCCGGCGGCGGCTTCTCCAACGTCTTCGCCATGCCCTCCTATCAGA
AGGCTGCCGTCAACACATATTATACCGCGTTTGCGCCAGCTTACGGCGCCGATCGCTACAACAACTCTCGGGCTGTTCGC
GGCTATCCTGACGTCTCGGCCAATGGCGCAAACTACGTCACCGCCGTCGACGGCAACTTCACTCTCTCTTTTGGCACATC
CGCCTCTGCACCCACCTTTGCCTCCATCCTCAATCTGATCAACGAGAAGCGCCTCGCTGCTGGCAAGACCGTCATCGGCT
TCGTCAACCCCGTCCTCTACGCAAACCCACAGGTGCTCAACGACATCATCAGCGGCTCCAATCCCGGCTGCGGCACCGAT
GGCTTCACCGCCGTCTCCGGCTGGGACCCACTGACCGGCCTCGGCACCCCCAACTACACCGCCATGGAGAAGCTGTTCCT
CAGTCTGCCGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62