GenePrediction:GLEAN_6605 Details

Name: GLEAN_6605
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:1201177..1198424 (- strand)
Length: 2754
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:1201177..1200878 (- strand)
Length: 300
Type: CDS
Source: GLEAN
Position: GCSC_156:1200808..1200205 (- strand)
Length: 604
Type: CDS
Source: GLEAN
Position: GCSC_156:1200134..1199938 (- strand)
Length: 197
Type: CDS
Source: GLEAN
Position: GCSC_156:1199876..1198964 (- strand)
Length: 913
Type: CDS
Source: GLEAN
Position: GCSC_156:1198904..1198755 (- strand)
Length: 150
Type: CDS
Source: GLEAN
Position: GCSC_156:1198698..1198424 (- strand)
Length: 275
>GLEAN_6605 class=GenePrediction position=GCSC_156:1201177..1198424 (- strand)
ATGGCGGCCGCCACGGATTACCCTACAATCGCCTCGCCTTCCGATGGCCCATCTGGAAACGCGACCTACAACCTGGGCTC
ACCAACCGGTCTATCTGCACCGATGACCGCTGCAATCGGCGGCGTCGAAAATGACGCCACTGCTGCGTCCGACCCCATAG
CCGGGCTGGGCTCGCCCACGAGCCCCAAGCAGACAGCCGGGTCGACCGAGCTGCCAAAACCAGTGCAGGATGTCCTGCAG
TCGGAAATTGGCATCGTCACGATGCTTGGCCGCCTGAAGCAGAGTGTCGCCACAGCCAAGGTACGTGTCACGCACACCTC
ACCCGCCCCCGTTCCCGGATGTCTGTTCTGACCCGGCTTCGGCTGCCAGGAATTCTCGCTCTTCCTCAAGAAACGTGCCC
AGCTCGAAGAAGAGTACTCGTCCGGCATGCGCAAGCTGGCTCGCACGACCCAGGATAACGTGGCGCGCAGCCAGGACACC
TTTGGTACCGCCTTTACCGAGATGATGGACATCCACACCCGCATGGCCGACAACGGCTACCAGTTCTCCGTCTCGCTCCA
CCAGATGCACGAAGACCTGCTGGAGCTGGCTGCCATGGCCGAGAAGAGCCGCAAGGGCTGGAAACAGACCGGCCTGGCAG
CCGAGCAGCGGATCGTCGACCTCGAGGCCGGCACGCGCAAGTCCAAGGCCAAGTACGACTCCCTGGCCGAGGAGTACGAC
CGCGTGCGTACCGGCGATGTCGGAGGCCGCCGCGCCGGCTTCGGCTTCAAGGGCCACAAGTCGGCCGCCCAGCACGAGGA
GGATCTGCTGCGCAAGCTGCACGGTGCCGACGAGGACTATCACAACCGCGTCGACACCCTCTCGCGGGAACGCGCCGAGC
TGCTGGCCACTGGCCGCCCAGAGATCATAAAGGCCCTGCAGGATATTGTCCGCGAGTGCGATGGTGGCGTCGTTCTTCAG
GTGCAGAAATATGGTAAGCAGTTTGGAAGTTATTGGAGGGGGGATCTTGTACATTTGCACAAACAAGGCTAACTCCTATG
CAGCTTCCTTCAGCGAGAAGCTGCTGCTAAGCAACGGCCTCAGCATCAGCCCTATCAAGTCGGCACAGAAGCCTGATGTT
CGCAGCCTGCGGGAAGTGGTCATCTCTGTCGATACCGAAAAAGATCTCAACCACTACATCTCCACTTTCCACAGCAAGGT
ACCGCCCAAGACCGGCGACCCGAAGTATGAGCGTCATCCGGTAAGTCAGCCCGTTTTCTTCCGCTCTTGTGCATGCATGC
ATACATGCTGACCACCATCAGGTTCTTGGCGGCGCGTCCAGCCAACCTCCGGCCTCTTCGCCGAGCGTTTCAAGAACCCA
CACCTCCTCGCAGTCCGTGTCTCAGCCCACAGGGCTGTCCCAGACTTCCTACACCGACACCCTGCAGTCTTCAGTAACAG
CAACCCCAACGCCGTATGGGTCTACCAGTGCATCCGCTGCGCGAGGTCCCCAAACTCTCGGGCCTGCCCCCAGCTCCAGT
CACCAGCATGAACGCAGCTTCAGCTATAGCAGCGCCTTCGGCCAGAACAGCCGGTCGTCCCAGGGCACCACTGCGCAGCC
GCCGCTTCTGCCGCAGTCGCCGCCGCCGCAACCGCACAACTCGTTGCCAAGCGTTGGTACTCCCACGACCAGTGGTCCTT
CCACCGAGAGCCCGTCAGCGTTCACTCCCGCACCTCTCGCAGCAACTCAAAGCTCGCGCTACTACAGCAACAACAACAAC
AGCCCGGCTGTCCCCCCTTATTCGGCACCTGCTATTGACGGCCCACCACAGCTTGGCGCCCTGCCTTTCCAGACAAAGGG
CAGCGCTCCCCCCCCAGCGGTAGCCCCGCCGCTTACCAGCACCATGCTCAACGCTCCACAGCTGCCGCAGCCACTGGTGC
AACAACAGCCGCAGCCGCAGCCGCAACAGCAGCTGCAACAGCAGCTGCAGCTGCAGCAACAGTCCAGCCCAATGCTGCCG
CATCTGTCTGCGCCCATCGGCGGCGGCGCCCCTTCGAAGCCTGTTTTTGGCGTCTCTTTGGAGACCCTGTACGATCGCGA
TGGCCTGGCCGTGCCCATGGTGGTGTACCAGTGCATCCAGGCCGTTGATCTATTTGGCCTCACTGTGGAGGGCATCTACC
GGCTCTCGGGATCACTGCCGCACGTGAACAAGCTCAAGTCCATGTTTGATACTGGTATGAAAGCCCACATATTGGCAACC
AGTTGTTGAAGATGTCTTGCTAACTCTCTCCAGACACTACCTCTCCCAAGCTGGACTTCCGCAACCCTGAAAACTTCTTC
CACGACGTCAATAGTGTGGCCGGTCTGCTGAAGCAGTTCTTCAGAGACCTTCCGGACCCTCTGCTGACTAGAGAACACTA
CGATCGATTCGTTCTCGCAGCTCGTGAGATCTCCATCCCTTTCTTGGCTCTTTTGATTACTTTGCTAACTAGCACCAAGA
ACACGACGATGACACCGTCCGCCGGGATTCCCTGCACGCGGTTATCAATGACCTGCCAGACCCCAACTACGCCACGTTGC
GGGCCTTGGTGCTGCACTTGAACCGTGTTGTCGAGAACATGTCCGTCACGCGCATGACGTCCCAGAATTTGGCCATCGTG
TTTGGACCAACACTGATGGGAGCCGGCGCCATCGACGCCGAAAAGGGCCGCTGGCATGTCCGTGTGATTGACACTATCTT
GCAGAACACGTACCAGATCTTTGATGAGGATTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62