GenePrediction:GLEAN_6606 Details

Name: GLEAN_6606
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:1197605..1194709 (- strand)
Length: 2897
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:1197605..1197558 (- strand)
Length: 48
Type: CDS
Source: GLEAN
Position: GCSC_156:1197488..1194891 (- strand)
Length: 2598
Type: CDS
Source: GLEAN
Position: GCSC_156:1194861..1194709 (- strand)
Length: 153
>GLEAN_6606 class=GenePrediction position=GCSC_156:1197605..1194709 (- strand)
ATGATTGCAGCCATGAAGACTTTCCTCGACACTAAAACCATTGGTGGCGTTTTTCATGCGAGTCTGGCCAAGCCTCTTTC
CTTCCTGGAAGCTTCCAAATGCTAACGCTCACCTCAGGGATCGGCAGAATCTCCCGACTACAACTATCCTCCGGTGCCGG
ATACTGTACAAGATGGCCCTGAGCTAATAGTCCGCTTTGACTCTATTGAGCAGTTCAAGGACATACACAAGACAGCCTCC
CTGTATGAAGAGAACCATGAGGCACAGGAAGTGGCTTCCTTCAACAAGGAAAACAACACGTTCAGGGCTTGGACCCTCAT
TGCCGTGCCCTCTGGAGGGGACGATGAGACGTGGGTCATGCTCGTGAAGGCACCTCTTGACATGGCTGCCAAGTTTCCCA
GCGTCGGAGAGACCTGTCATGTCCACGTCGTTGATCCAGACACCGGTATAGGTAGCACCATGTGGTGGCTGGCACGGCGC
ATGAGCAACAATTTCGCACTCATGAGCAAGTCAAAGAAGAGCTGGGCGAGCCTTCTCGTGTTCAACGTCACTCTATCACA
GAAGGATGACGACGCACGGTCCGTGATTCACGCCCTAGTTTCAGATGAGAAAGACCAGGAACGGACCCTAGATTCTCTGA
TCTTGAACGACAACAATTCTATTCATGTCGGCTTCTTCTTTTCAAAGCCCAGTGCTACATTTGATGCCGAGATGAGGTGT
TTGGGCAGGCTTTCCCGAGCAGCCACTATTCCGTCTATAGCCAATACCAGCAATGCTGCTCCCGGGCAGGTGCCAAAGAA
AAACAAGATCTACCATAACCAGAATCAACACCAGCCGAGCAAGCCCCCGTCGAGTTTCGGAAAAGGGAGGTTTCCGAACC
GTCGAGCAATCCAAGTCAAACAATTTGCCGCGTTTAAGTATCTTCTAGACTTCCGCAATCCGGCTTTCTCGGTGAACCTG
TTCGAGCATTTCCCACATATGAAAAACCCAGACCAGTTTAACTCTGGCATCCCGACGTTTATCATGAACAAATATCAGCG
CTTGAACGAGCATCAGAGAGAGGCATACGACGGTCTTCTTTTCGATATGCCTTGTGGGCTAGGTCTGCTTCCCGGGGGAC
CGGGTGGGGGCAAGACGGACTGGGCGATGACCGTGATCGGACTTCTCCAAAGCAGAACAACTGCCAAGGTTCTGTACCTG
CTAGACATCAATGATCCCCTAGACGATGCCACAGTCAAGTATGTTAAGATGATGCGGGGTGCTGGGCTTGCGAAGCGAGC
CATCAGGATGAGGACATTTGGTACGGAGCTCAAGAGAAGCATTCGCTTCGGGCCGGCACAGAATCGTGCACAGGGTGATG
GCAACCGAGACTCCGGCCAAATTGCCCGTCTCAGCAATATTGACGAACCCGATGTCGACTTTTCGAAAAATTTCTTGCGC
ATCTACATGGCTCAATCGACAGAGCCGAGTCAGAAAACCAATCGTCATCGGGAGATTATCGTCACACTTGATGAGGCAGC
GTGGAATCATTACGATGAAAACCTATCTGACTTTCGCAAGCTCACAGAGCTGTTGGTAGCGAATGATGGCAACGTCCTGG
AGAATGGAACGCTTCGGCGGGAGATTTTTCTCCTGTACCAAACAGTGCTCCAAGAAGCCGATTTCATCGCTGCAACACCC
TGTGTGGCGGCGACGGCCTTCAAAGATATGTTCTTTCCAGATCTTGTCATCTTCGATGAGGCTGCCCATGCCCGGGAACT
TTCGACACTGATTGCAATTGGAAGCTTTTGCCCTACCGTGGGCTGGATTTTCATTGGCGACCATCGACAGACCCAGCCAA
CTGCAAAGAGCCGGCAGACCAATCCATTGGCACTGCAACTGCAAACTTCTGCGATGGAGCGAGCATACCTTGCAGGTGTT
CTTAAGTACCAGTTGCTGATTAATCACCGGGCGTATGGACGGCTGGAGCGCTTACCGTCTAAATTGATATACGATGGCCA
AATGGTGTCAGGCATTCCTCACGCAGACAGATTCCCCCCATGTGCCGGGTTCGTCCGGAATTACTTCCGCAATCTTTCGG
GAATGAACTGCGTCGTCCCACGGCTGATTGTACACCTGCTGCAAATCGGCCATGCATCCCAAGTTGGTACAAGCTGGTAC
CACCAGCAGCACCTGGAATGGACCATGCAGCGGGTCCTGGACCTGGTGCTGGACAAGCATTTCCGGTGTACCGGAAATAC
GGCCAAGCCTGGTACAATATTGCTTCTGACCCCTTACAAAGCTGCGGTAGCGAAGTACAAAGAAGCGATCGAGACACTTG
CAGCGGCTCATCCCGGATTCAGCATTCTGGAGAGGGTGGAAGCTCGGACATGGGACAGTGCCCAGGGACACGAGGCTGAC
ATTGTCGGGATCGACTATGTGCGAGAGCATCCAACCGATTTTATGGATGGAATGTACCGATTTAACGTAGGATTGACACG
CGCACGGCAAGGCGAGTGGCATCTAATGCACCCAAACATGCCAATCTCACATGGGTTCCGCTACACCCGATACTTGCGCA
AGCTCTACGACGCGTGCAAGAATGGTCGTGAAGGAATCAACGAAGGGCGTGTGGTCAACCTGCGCTGGAGCGATGGCAAG
CCATCAACAACACCCGACGAAGCGGTCTGCAAGCACTCTATAACATTGCTCTCACAACGCCACGAGCTCTGGCTAGTAAG
CCTAACAATGGAGCTGTCTCGAAGTGGGCAGTGCGCTCGTGCAGTGGCAGGGCAACATCTTCGGCTGAAAAAGGTGCAGA
TGTGGTATCGACCCCGGACTCGACGTGGAGCACTTTGTCAGCAAAGGCGGTCAAGGCGGCCAAGGAGGGCGAGCTCAGAG
ACGGTACAGTGGTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62