GenePrediction:GLEAN_6608 Details

Name: GLEAN_6608
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:1186300..1185087 (- strand)
Length: 1214
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:1186300..1186202 (- strand)
Length: 99
Type: CDS
Source: GLEAN
Position: GCSC_156:1186136..1185087 (- strand)
Length: 1050
>GLEAN_6608 class=GenePrediction position=GCSC_156:1186300..1185087 (- strand)
ATGACGCATCCCACGATGATGCGGCCGCCTCCGGTGGACCCGGCGCGGTCGATGATGGAGAACAACCTGGAGGTGACGGA
GATGTCGGTTCTAGGGCCTGTACGTTTTCTGTCGAGGGTCGAGGGCGGCCTGCAGACGGCGAACCTACCTGCTGACCTCA
CCAGGACGTCTATACGAACGCGCGGCCGCCATGGCACCCGCCGGGGGCGCGCGGCATCTACGGCGGATCGGTGGTGTCGA
TGTGTCTGGCGGCGGGCCAGCGGACGGTCGAGCCGGACTTTGCGCCGCACAGCTGCCACTGCTACTTCTTGCTGGCCGGC
AACGCTGCCATTCCGATCCTGCTGCACGTGGAGCGCGTGCGTGACGGCCGGTCCTTTGCCACGCGCACGGTGCAGGCTCG
CCAGCGGGGACGCTGCATCTTTACGCTGACGGTATCGTTTGCGCGGATGCCACCCAAGGACACGAGCACGAGCATGTCCA
CGACCGCTCCTCTCCACCATGCAGTCGCCATGCCGACGTCACGGCCACTCCAGCCGCCTGCCGACTGGGATGACGACGGC
GGAATCGAGCCGCGGCTCTTGCGGGCGCTCGGCATCGCTCCGGTCGAGCAGCCGGTTGTGGCCGGCCCCATGCACATCGT
CGGCGACGTCGACGCGCTGCCGCACCGCAAGAAGACACAGCAATGGGTGCGCGTGCGCGGACGCATCTCGGCGGCTGGCG
GCCGCGCAGCCCATCTCTGCGCCCTCGCCTACCTCAGCGATCGCTACTTTATCGGCACCATCTGCCGCCTCCATCGCCTC
TGGCGCCTGCCCTTTTCGGTCGAGAGCGTGCTCGGCGAGGACGACGTCGGAGACGAGAAGGACGACGACGACGACGACAC
CACCACCTACAACCAGCTCGTTCGCAGCAGCCCTTCGCTCCGCCAGCTCATCCGCCAACACGTCGAGGCTGAGAGCGGCG
GCGTCCCCCTCGAGGCCTACCGCGGACGCCCTCGTCTCGGCATGGTCGTCAGCCTCGACCACACCGTCTACTTCCACGAA
CCCGATCGCGTCTGCGCCGACGACTGGATGCTCGTCGAAATGGATAGCCCCTGGGCCAACAGCGGCCGCGGCGTCGTCAC
GCAGCGCATCTTCAGCAAGGACGGCATGCTGCTGGCCACCTGCGTCCAAGAGGTGCGTGCAGCTGAGAACAGGACAGCAG
TCAGAGGATGCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62