GenePrediction:GLEAN_6610 Details

Name: GLEAN_6610
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:1173325..1171694 (- strand)
Length: 1632
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:1173325..1173254 (- strand)
Length: 72
Type: CDS
Source: GLEAN
Position: GCSC_156:1173202..1172143 (- strand)
Length: 1060
Type: CDS
Source: GLEAN
Position: GCSC_156:1171875..1171694 (- strand)
Length: 182
>GLEAN_6610 class=GenePrediction position=GCSC_156:1173325..1171694 (- strand)
ATGTCTCAAAAGAGCACGGGCAAGGCCGGGGTGATCTATGCTCCCGGCGATGCCAACAGCATGGATAAGTTGGTGCGTCT
ATCTCCTCCGGGGCTGCCCCCCCGTTCACCCTAACAAGAATAGGCCAGCGCGGTTCTCGACGACCTGCTGTACAACGTCG
TGCACGACCTCCTGATGAAGACGCACCGGGACGAGAAGCAGGCCCGGGCAGCCACGGCGGCCATCCGGGTGGAGACGATG
GCGGCTGAGGCGGCACAGGACCTGGCAGGCGCCACGGGCGAGTCCCGGGCAGGCGGTCACTACGAGACGGACTCGGCCCA
GTACGAAAACGGACAGGTCAGCCTCCGGATCAATCCGCTCAAGACGACACACGACATTCTCTGCCCGCGCTGTCACCTGC
CGCGGCTGCTCTACCCGGTAGATGGCAAGGGCGCACGGAAACCGGACCCGGCGGTGACGTACTGCAAGAAGCATCCGTAC
ATTGACAAGCCGGGTTGCGACATATACGGACAGATGTGGGTGGCGCCGGGGCCGGGGCGCGGCAAGAAGAAGAAGGACTT
TGACAAGAAGGTGTCGGCGGCGATCCACGCGGCGACCACAGGCATCGAGACGCCCAACGGAGCGGGCGGGGTATCGAGCG
AGCAGCGGCCGCCCAACGTGCTGTCATTCCCATCGGCGACGTGCAGCAAGTGCAAGCGGTGCATCCTGGTGTCGCGGCTG
AACAACCACATGGGGTCGTGCATCGGCAACAGCGGCCGCAATGCCAGCCGGGCGGCAGCGGCGAAGATCAGCGGCAGTGC
GGGGGGCGGGGCGCTGCACGACCACACGCCACCCAACAGCCAGAAGGGGACGCCGCTGCCAAGCTCGCAGGCGACAAGCC
CGCGGAAACGGGACGCGGACGACTTTGACGAGGGTGACGACGACTCGGACGCGGGCGGGCACAGGAACGGGAGTGCGAAC
GGCCATGGCCACGGTAGCCACAGCAGTAAGCCCAAGAAGAAGCTCAAGTCGTCGGCAGGCGGCAGCGGTGGTGGCAGTGG
AGGGGCGACGAACGGGGCGACGACACCATCCAGCCAGTCCAGCCAGGGCCTCTCGACGGCGATGCTAAAAAAGCTCAATA
TAAAGAGAGCGGGAAGTGGCGGGCCGACGAAGAAGAAGAAGCTGAAGCCGAGCTCAGCTCTCAGTTTTGAGCGCAAGATG
GGCGGCGACGACGACTATGGGATGGATGACGACGACGACAACAACAACAACATCAACAACAACAACGAGCACGACCACGG
CGGCGACGACTACGACGACGATGACGATGACGACGACGACGACGACGACGACGACGCCCGCAGCAGCATAAACTTCAAGG
CGGTGACGGCAGCGACAGCCGGCAGCAACGGCAGCAGCCACAACAGCCACGGCGGTATGAAAAAGAAAAAGCAGATCTCT
ATGGCGACAGGGTCGGTGTCGTCTACGCCGCCCAAGAAGACGACCAAGGTGCCGATTCCGGTGCCGGGCGTCAAGAAGGT
CAAGCTGGTCAACAAGCCGCCGCCGTCGCCGCCGGCATCAAAGAGCGGGAAGGTACACGAGTTGGACGTCGAGTCGGAGT
CGTCCGGGACAATGTCGTCGCCGCGGACGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62