GenePrediction:GLEAN_6612 Details

Name: GLEAN_6612
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:1164104..1161520 (- strand)
Length: 2585
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:1164104..1163328 (- strand)
Length: 777
Type: CDS
Source: GLEAN
Position: GCSC_156:1163256..1162879 (- strand)
Length: 378
Type: CDS
Source: GLEAN
Position: GCSC_156:1162806..1161780 (- strand)
Length: 1027
Type: CDS
Source: GLEAN
Position: GCSC_156:1161719..1161520 (- strand)
Length: 200
>GLEAN_6612 class=GenePrediction position=GCSC_156:1164104..1161520 (- strand)
ATGAGTTCGTTGAACTCGAGATTCAAAGCCCTTGGTTTTGGAAAGCGCAAGTCCACCACCAGTATACCAGGCAACTTTCC
ACCACAACAGGCTACCTACGCTTCCAACCCACCGCCTCCCCAGATTTCACGACAGTTCTCACCCCATCCCACTCCCCCTC
CTTTTCAGCCGCAAACACAACAGCAGCAACCTCAACACGCTCAGACTCAGGCGCCGCCCCCTTCGCACACTCCTCAACCT
CAAGGAGCACAGGCGCCTCTTCCTCCTTTTCCATCTCCGACCCAGATTCCTATCTCGTCAAGCTCTCCTCCCCCTCAATC
CTTTGGTGCCGCGCCTCTAGGCATCCAGGTGCCCAACCAAACGTCGCCTCCTCCCCAGTTACAACAGCAACAACAACAAC
AGCCGCCATCCACCATGAATCATAACATACCGGGCGTTCGTCCGCCCAGCTACAATTCTGGATATCCCCAACCCGGTGTC
CAGAACCCTCTCGGTCGTGCAAGTCCAGGCGCTCCTCGTGCGCCACCAAGCCAGATGGTCGGTGGCCCGCCTCCCATCAA
CACTGGCGCTCCCGTCTCCGGCTACCCACCGCCGATGCAGCTTCCGGGCGGTACTCCACAATCCATGGGTGGACCGCCTG
GATACACCGGCGCCCCTGCTGGCTACGGCGCACCTCAGCAGGCCCAGCAGCCTATACAGGGCATCTACGGACGTCCTGCG
GCCGAGGTTGAGGGAAGCAGCCGGAGTAAAGCACAGCTGATCGTTGGTATCGATTTTGTACGTTGCTACGCCTCTAATTT
TGCTTCTTTCTTTTTTTCCATGCGTCGCCACCCGCTGACAGGCGACAGGGAACCACCTTTTCTGGTGTTGCATTTGCGTT
CGCCACGAATAACGAGGCAAAAGAAGACATCATCACAGAATGGCCCGGTGCTGGTTCATACACGAAACAGAAGATCCCCA
CGGTGCTCTACTATGACCAGTATCAGAAAGTTGTTGGCTGGGGCCCCGATATTGCCGATGCCCTCGCCCCGACTGGCTAT
CCCAAGGCTGGCGTGCAGAAGGTGGAATGGTTCAAGCTGCAGCTGATGCTGTCTGGAAATACGTACATCGACCCCATCAA
CCTGCCGCCCTTGCCTCCTGGAAAGTCGGAGATCGACGTCGCCGCCGACTACCTCTTCAAGCTGCGTCAGGCCATGCGTT
CTGCCTTGCAAAAGACGCTCGGCGAGGTGTTCAACCGTGAGGAGCGCAACATTCGCTAATACCTCACCGTTCCTGCCATC
TGGAACGACGCCGGCAAGGCTGCCACCCGTGCTGCTGCGATCCAGGCCGGCTTCCTGCGTGACGAGAACGACAACCGTCT
GACCCTGGTCAGCGAACCCGAGGCTGCTGCCCTCTTCTGTTCCAAGACGGGCCTGCTGAACCTCAAGGTTCACGACGCTG
TACTGATCGTCGATTGCGGTGGTGGCACCGTCGATCTGATCGCCTACGAGGTGGAAGAGGAAAACCCCTTTACTGTCGCC
GAGTGCACGGCTGGTTCCGGCGACTCGTGCGGCTCCACAGCGCTGAACCGGAACTTCAGCAACATTTTGCGCACCAAGAT
CCGCAAGATGAAGCTGCCCGATGGGTCCAAGATGGCCGGCCGTGTCTACGCCAAGTGCATCATGGACTTCGAGAACCGCA
TTAAAGCGGACTTCCGCAACAACGGCCAGAAATGGGCTGTCGATGTCGGCATCGAGGCCGAGTTCCCCGAGGCCGGCATC
GAGGAGGGCTACATGACCTTTACCAACGAAGAGATTCTGCAATGCTTTGAGCCCGTTGTTAATCGCATTCTCGAGCTTGT
CCGCAACCAGATCATCGCCATCCAGGCCCAGAACCGGACACTCCAGAACATTCTGGTCGTCGGTGGTTTCGGAGCCTCGG
AGTTTCTGTTCCAGCAGATCAAGCTGCACGTGCCACCACAGTTCCAGTCCAAGGTCGTCCGGCCCATGGACTCCGTTGCT
GCCATTGTCAAGGGTGCCGTAACGGCTGGTATCACCGAGCGGGTTGTTACCCAGCGTGTGGCCCGTCGCCACTATCTCAT
GGCCACGCTGCAGCCCTTCAAGGAGGGCTACCACCCAGAGGCCTACCGCGTGCCGTCGCTCGACGGCAAGGACCGCTGCA
AGTTTACGCGGCAAATATTTGTCCAGAAGGGGCAGAAGGTCAAGATTGGCGAGCCGGTCAAGGTTTCGTTTTTCCGCCAG
GTCGCGCCAGGTGCTACGCTCATGTACGAGGACATTCTGTATGCCTGTGACGAGGATGTGTGTCCCGAGTACACAAAGGA
TCCCAGTACGTTTCAAAGCAGTTCCACTACAGTTTCATCCCAGTTCTCGCTGACCGTCGCTGCAGGAATCAAGGAAGTCG
TCACGCTCACGTCCGACCTGTCGCGGAAGAATCTCGAGAAGGACTTTGAGCGTATGGACACGCCACAAGGAACGTTCTAT
CGGGTGTATTTCGACATTTATCTGACGCTGGACGGCTCCGAATTCAGTGCCGAGCTGGTGTGCCAAGGGGAGGTCATGGG
TCGTTGCCGTTCTCGCTTCCGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62