GenePrediction:GLEAN_6613 Details

Name: GLEAN_6613
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:1160810..1158867 (- strand)
Length: 1944
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:1160810..1160786 (- strand)
Length: 25
Type: CDS
Source: GLEAN
Position: GCSC_156:1160703..1160169 (- strand)
Length: 535
Type: CDS
Source: GLEAN
Position: GCSC_156:1160107..1160023 (- strand)
Length: 85
Type: CDS
Source: GLEAN
Position: GCSC_156:1159958..1158867 (- strand)
Length: 1092
>GLEAN_6613 class=GenePrediction position=GCSC_156:1160810..1158867 (- strand)
ATGAAATACGTGCTGGTTTCGGGAGGTAAGAAAAATCAGAAGAAAAATCGAGTTCCCTCACAGACATGAAGGGCCTCTCT
GACTCTCTGGCTCTCCCCCGCGTGCAGGAGTGATCTCGGGTGTGGGCAAGGGCATCATTGCGTCCAGCACGGGCCTGCTG
CTCAAGTCGATGGGCCTGACGGTGACGAGCATCAAGATCGACCCGTACATGAACATTGATGCGGGCACGATGGCGCCGAC
GGAACACGGCGAGGTGTACGTGACGGATGACGGCGGCGAGATGGACCTGGACATTGGGCACTACGAGCGGTACCTGCTGA
CGACGCTGACGCGCGACCACAACCTGACGACGGGCAAGATCTACCAGCAGGTGATCGAGCGTGAGCGTCGCGGCGACTAC
CTGGGCAAAACGGTGCAGGTGGTGCCCCACTTGACAAACGCAATTCAAGACTGGATTGAGCGTGTGGCCAAGGTGCCGGT
GGACGAGTCGGGCGCGCAGCCGGACGTGTGCGTGATTGAGCTGGGCGGCACGGTGGGCGACATCGAGAGCGCGCCGTTCA
TCCACGCCATGAGCCAGTTTCAGCGACGAGCGGGCAAAGGCAACTTTCTGCAGATCCACGTGTCCTACGTGCCTGTGATC
CCGTGAGTGTGGTGTTGTTGCGTTCCTTGATCGGGTAGGTTGTGCAGCCACTAACAGGACCAGGCCAGGGCCTCATGGCG
AGCAAAAGACGAAGCCGACGCAGAGAGCGGTTGGGGACGTGCGCAGTGCGGGTTTGAACCCGGATATTGTGAGTTTCATG
CTGTGCAGTGCTGTGTTGTTTGTGGTGAGGCTCGCGGCTGACCAGACGGCAGATTGCGTGCCGCTGTGAGCGTCCGCTGG
AGGACTCGGTGATTCAGAAGATTGCCAACATGTGCCAGGTGGAGACGAAGCAGGTGCTGACGGTGCACAACGTGTCGACG
ACGTACCACGTGCCGCTGCTGCTGCGCAACCAAAAGTTCCGCGAGAGCATCAGCGGGCTGCTGGAGCTGGAGGCCGTGCC
ACGGGCGCCGGAGCTGGTGGTGCGCGGCGAGAAGATGTGGCAGCGGTGGGTGGAACTGACGCGCGGACAGGACAGCAGCG
TGGACACGGTGACGATTGTGCTGGTGGGCAAGTACACGACGCTGGAGGACGCATACATCAGCGTGGGCAAGTCGCTGGAG
CACGCGGCGATGTACTGCAAGAAGAAGCTCAACCTGGTGTGGGTGGACGCGTCGAATCTGGAGGACGCAGCACTGGAGGC
ATCGCCGGCCGAGTTCCACAAGGCGTGGCACGCGGTGTGCACGGCGGACGGCATCCTGGTACCAGGCGGCTTTGGCGTGC
GCGGCACCGAGGGCATGATCAAGGCGACGACATGGGCGCGCACCAAGAACGTGCCTTTCCTGGGCGTGTGCCTGGGCATG
CAGCTGGCCATTGTGGAGTATGCGCGCAACGTGTGCGGTATTGCTGGAGCCGGCAGCGAGGAGCTGCACCCGGGCTGCGA
GAGCCCGGTGATCGTGTACATGCCTGAGGTCGACCGGACGAAGCTGGGCGGGACCATGCGTCTGGGCAAGCGGCGCTGTG
TCTTCCAGCCCGACACGGCCGGCTGGTCTCGCTTCCGGGCGCTCTACGGCGACGCGGCCGAGATTGAGGAGCGCCATCGC
CACCGCTATGAGGTCTCGCCCGACATGTTTGAGCGGCTGGAAGCGCCCAAGGACCTCGTCTTTGTCGGCAAGGACGAGAA
GGGCGAGCGCATCGAGGTCATCGAGCTGCGCAGCCACCCCTTCTTTGTGGGCGTGCAGTTCCATCCTGAGTATCTCAGCC
GCGTCCTGGCGCCCAGCAAGTCGTACCTGGGTTTCTTTGCGGCTGCTGCCGGCGTGCTGGACGATATAACCGCTCGCTTC
AACGGCAAGGAGGCGACCGTTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62