GenePrediction:GLEAN_6614 Details

Name: GLEAN_6614
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:1150160..1146126 (- strand)
Length: 4035
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:1150160..1150077 (- strand)
Length: 84
Type: CDS
Source: GLEAN
Position: GCSC_156:1150015..1146705 (- strand)
Length: 3311
Type: CDS
Source: GLEAN
Position: GCSC_156:1146654..1146126 (- strand)
Length: 529
>GLEAN_6614 class=GenePrediction position=GCSC_156:1150160..1146126 (- strand)
ATGGCCCCTTCGCCTCTGGTCGACAACGCCCAGATCAAGGGCGCCGAGCTCTTGAATCCCCTCACCGTCCACTACCATGC
CTACGTCTGGCCCCTTTTGTCATCATCTGGCCCGTCTTCTTCTTCTACTACCTTCTCCGCCCGAGCACTACGAACGGTAC
ATTGGCGCGCCCGAATGGACTTTTGTCTGGGTCGGGTCCATCATCACGGTGCAGAGCCTGATCTGGCTGAGTACCAATTG
GAGCGTCAATGTCAAGGCCATCTTCACGGCCACCAGGGCCAGCTCGGTCGAAAGTGCCCGGCTGATCAAGGTGATCCCCG
TCGCAAACGCTGGTGCCCCGGAAATCTGCAAGCTCGAGCGCCATCAGGTGGCTGGCAAGCCGGTCCTGTCGTTCCTCTTC
CAGAAGCGTCGCTTTCTCTACAGTCCCGAGACCAAGTCTTTTGCCACGCTCGCGTACGAGGTCGATGTCGACCCCAAGCC
GCTGCTGGGCAAGTTCCAAACGTCCCGGGGTATCGACTCGGACGCCGAACTCACCCGCATCGAGCAGCACTACGGCACCA
ACACGTTTGACATTCCGGTGCCCACCTTCTCCGAGCTATTCCGCGAGCACGCCGTCGCCCCGTTCTTCGTCTTCCAGGTC
TTCTGTGTCGGTCTGTGGATGCTCGACGAGTACTGGTACTATTCGCTCTTCACCCTCGTCATGCTCGTCATGTTCGAGAG
CACTGTCGTCTGGCAGCGCCAGCGCACCCTGAGCGAGTTCCGCAGCATGGGCATTAAGCCCTACGACGTCTGGGCCTACC
GTCTGAGCAAATGGACCGAGGTGTCCAGCGACCGGCTCTTGCCTGGCGACCTGGTCTCGGTCTCACGCACCAAGGAGGAT
AGTGGCGTGGCCTGTGACATGCTGCTTGTCGAGGGCACCGCCATCGTCAACGAGGCCATGCTCTCGGGCGAGAGCACCCC
GCTTCTCAAGGACTCTGTTCAGCTCCGTCCGGCCGACGCCCCTCTCGACCCCGAGGGCCTCGACAAGAACGCTTTCCTTT
GGGGCGGTACCAAGGTCCTGCAGATCACGCACGGCAATTCCGAGGACGCCAAGGCCAAGCCGGCCTCGGGTGTGCCCAAG
CCGCCCGACGACGGGGCCATGGCCATTGTGATCAAGACCGGCTTCGAGACGTCGCAGGGTAGCCTCGTGCGCACCATGAT
CTACTCGACCGAGCGTGTGTCGGCTAACAATGCCGAGGCCCTCCTGTTCATCCTGTTTCTGCTCGTCTTCGCCATTGCCG
CGTCCTGGTACGTCTGGGACGAGGGCGTACGGAAGGACCGCAAGCGCTCGAAGCTGCTGCTCGACTGTGTGCTCATCATC
ACGAGCGTCGTGCCGCCCGAGCTGCCGATGGAGCTGAGCCTGGCTGTGAACACAAGTCTGGCTGCGCTGGCCAAGTTTGC
CATCTTCTGCACTGAGCCCTTCCGGATCCCGTTTGCCGGCCGCATCGATGTGGCCTGTTTCGATAAGACCGGCACGTTGA
CGGGCGAAGATCTGGTTGTCGAGGGCATCGCCGGTCTGGATCTCAGCCGCTCAGGCGCCGACGTCTCGTCTGAGCGCGAG
GCCGACGGCGCACACAGCCACATTACGCCCGTCCACGAAGCCAGTCTCGAGACTGTCCTGGTTCTTGCCACGGCCCATGC
GCTCGTCAAGCTCGACGAAGGCGAAGTGGTCGGCGATCCAATGGAAAAAGCCACGCTTTCAGCTCTCGGCTGGACGCTCG
GCCGCAACGACATCCTCTCGAACAAGGCAGCCACGGCAGGTGCCCGCACGAACGGAAGCACCGTGGGCACGGTTCAGATT
AAGCGGCGCTTCCAGTTCTCGTCGGCCCTAAAGAGACAGAGCTCCGTCGCCACGGTGGCCGGCCGCGACGCCAAGACGGG
CCAGCGCATCCAGGGCACGTTTGTGGCCGTCAAGGGCGCGCCGGAGACGATCATGAAGCGGCTCGTCTCGGTCCCGAACG
ACTACGAGGAGACATACAAGTACTTTACACGCATGGGCTCGCGCGTGCTCGCACTCGCATTCAAGCAGCTGACGGTCGAC
CACGAGCTCGGTGCCGGCAAGATCAACGACCTGAAGCGCGAGGATGTCGAGGCCGGGCTGACCTTTGCCGGTTTCCTGGT
GCTGCACTGCCCGCTCAAGGACGACGCCAAGGAGGCGGTGCAGATGCTCAATGAGAGCAGCCACCGGGTGGTGATGATCA
CGGGCGACAACCCGCTGACGGCCGTGCACGTGGCGCGCGAGGTCGAGATCGTCGACCGTGAGGTGCTGATTCTGGACGTT
CCCGACCACAGCGACGGCGGCAAGGACCTGGTCTGGCACAGCGTCGACGACAAGGTGCGCATCTCGGTGGACCCGACCAA
GCGGCTGGACCCAGACATTCTCCGGACCAAAGACCTCTGCGTGACGGGCTACGCGCTGTCGCAGCTCAAGGACCAACCGG
CCTGGCTCGACGTCCTGCGGTACACGTGGGTGTATGCGCGAGTGTCGCCCAAGCAGAAGGAAGACATCCTCCTCGGACTC
AAGGACATGGGCTACTACACGCTGATGGCAGGCGACGGGACCAACGACGTGGGCGCGCTCAAGCAGGCGCACATTGGCGT
GGCACTGCTCAACGGCACGCCCGACGACCTCACGCGCATTGCCGAGCACGCGCGCAACACCAAGATGAAGGAACTGTACC
AGAAGCAGGTGGACCTGATGAAGCGCTGGAACCAGGCGGCGCCGCCGGTGCCGGTGGTGATTGCACATCTGTACCCGGCA
GGGCCGAGCAACCCACACCTGGCCAAGGCGGTCGAGCGAGAGGCCGCGCGCAAGAACATGACGCCCGAAGAGTACACCAA
AGCGTTTGTGCCCAGCGGCGGCGATGTGGAGACGATCACGTCGCCGGCCGCGCAGCAGCTGCTCAACCAGGGTCACAACG
CGCCACGAAACCAGATGCAGCAGAAGGCAGCCGGGCTGGCGGACCAGCTGACGGCGAGCATGATGGACAGCGAGATGAAC
GAGGACGAGCCGCCGACGCTGAAGCTGGGCGACGCGTCGGTGGCGGCGCCGTTTACGAGCAAGCTGCGCAACGTGATCGC
CATCCCCAACATCATCCGCCAGGGTCGCTGCACGCTCGTGGCCACGATCCAGATGTACAAGATCCTGGCGCTCAACTGCC
TGATCTCGGCCTACAGTCTCAGCGTCCTCTACCTGGAGGGCATCAAGTTTGGCGACGGCCAGTACACCATCAGCGGCATG
CTCATGAGCGTGTGCTTCCTGTCCATCTCGCGCGCCCGCTCGGTCGAGGGTCTGTCCAAGGAACGGCCGCAGCCGAACAT
TTTCAACTTTTACATTATCGGGTCGATTCTCGGGCAGTTTGCCGTTCACGTGACGACGCTCATCTACATTGCGCGGTTCT
GCGACAAGATAGCACCGTGAGTTCCACTGTCTTTTTTAGTCATTCCTCCACCCGCTAACAGTCCAGTCGCGGTGACGATA
TCGATCTTGAGGCCGACTTCACGCCCTCGCTGCTCAACAGCGCCGTGTACCTGCTGCAGCTGATTCAGCAGATCTCGACG
TTTGCGGTCAACTACCAGGGCCGGCCGTTCCGCGAGTCGCTGTCGGAGAACAAGGGCATGTACTACGGCATCGTGGGCGT
GACAGGGATCGCGTTTGCCTGCAGCACCGAGTTCGTCCCAGAGCTGAACGAGATGATGAAGCTGGTGCCCTTCTCGAGCG
AGTTCAAGACCACCATGACCGCGGTCATGGCCATCGACTATGCGGCCTGCTATGTGATCGAGGTGATCCTCAAGTTCCTC
TTCTCGGACCTGCGGGCGCGTGACATTGCCGAGCGCCGGCCGGACCAGCTGGAGCGCGAGCGCGTGCGCAAGAAGGCCGA
GCAGCTGAGAAAGGCCGAAGAGGAGGACAAGCAGCGGCTAGACAAGGTGGCTGTCTTTGAGCAGCAGCTGCTGGAGCGCC
GGCAGCGGCTACAGGCGGCACGTCAAGGGCGATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62