GenePrediction:GLEAN_6618 Details

Name: GLEAN_6618
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:1134827..1133283 (- strand)
Length: 1545
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:1134827..1134706 (- strand)
Length: 122
Type: CDS
Source: GLEAN
Position: GCSC_156:1134648..1133283 (- strand)
Length: 1366
>GLEAN_6618 class=GenePrediction position=GCSC_156:1134827..1133283 (- strand)
ATGATCTTGTATGATTGGCCGCACGGCGGCTCCGACAAGGGCGAGGCTTACTATCGCAATCTCTACAAGGACCGCATCGA
TTTCCGTGAGCTGGGTCGTTCTGATGCAGCGCTGGCCGCAGTGTAGGTCCGCCCTGTTTTGGTACTCTTTCTTCGTCACC
CACTGACGTGCAGAGACAGACTCGACAATCACGGCCAGATTGACTTTCAGGATGCGCAGGCGGTGAAGCAGCTGACGACG
GCGCTGCTGCGGCGCGACTTTGGCCTCGCCGTCGACCTTCCCGACGACCGACTGTGTCCACCGGTGCCCAGTCGCCATAC
TTACATATTGTGGCTCAAGATGCTTCTGGACAGCAGCAGTAGTGGACGTGCTACTGAGCCGTTAATCGGGCTGGACATTG
GCACCGGGGCCAGCTGCATCTATCCGTTGCTGGGCTGCGTGCAGCGGCCGGATTGGTGCTTTGTGGCGACGGACATTGAC
GAGGACAGCCTTGGCTGTGCGCGAGCGAACGTGAGACGCAACCAACTGGAGGACCGGATCCGGGTGCTGCCGGTGCGCAC
GCCGGACGACCGGCTGATCCCCGACGAGACGGGGTCACGGCCGCTGTCGTTCACGATGACGAACCCGCCGTTCTACGAGT
CCGCTGCCGAGATGACGGCGTCTGCCCGAGCCAAAGAACGGCCACCGCATGCCGTCTGTACGGGTGCAGCCAACGAGATG
GTCACGCCGGGTGGCGAAGTCGCGTTTGTGGGCCGGCTGCTGGCCGAATCGGTCGAGAGACACGCCGCCGGCCGCGACGT
CACCGGCTGCTGGTACACGGCGATGCTGGGCAAGCTGTCGAGCCTGGTGGCCGTAGTCGAGCAGCTGCGGGCTCGTGGCA
TCGACAACTACGCCGTTACGGCCTTTGTGCCGGGAAGCAGCAGCAAGAGCAGCAAAAGCAGCAAAAGCAGCAAAAGCAAG
ACCCGTCGCTGGGCTATCGGCTGGAGCTTTGGTGGCATGCGGCCGTCGGCCGAGGCAGCACGGGGGGCCGATCACGGCGG
CGGCATCGATGCGTTTCGCCACCTGCTGCCCCCCAGCCCAGAGGCCGACGTCTGGAGCGTGGGGGCTTCGTCGTCTTCGT
CTTCGTCACGGCCGGCCGCCATCGCCCGGCTCGCCAACGCCCTGGACGCCCAGATGCACGAGCTCGAACTGTCCGCCTGG
ACATGGGACCGCCAGCTTCTGCGCGGTGTCGGTCGGGCGCGCGAGAATGTCTGGGCGCGGGCATGGCGTCGCCGGAAGCA
GCGAGCAGAGCAGGAAGCCGAAGCAAAGGGCAACGGACAGACAGATGACCATGTGGACAATGTGCCTGCGCCGGGGGAGT
GTGCCTTTGGCTTCGTTCTCTCGGTGCAGGTCGGCGTGGCCGAGACGGTCGTGCGCTGCCGCTGGATCGAGGGACACAGC
GACGTCCTGTTCCAGAGCTTCTGCGGCTTTCTGAGGAGGAAGCTCAAGGAGACGGATCCGACAGGGGACGACGACCGCAT
GGAGGATGTGTCTGGGAAGCAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62