GenePrediction:GLEAN_661 Details

Name: GLEAN_661
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1270304..1272901 (+ strand)
Length: 2598
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1270304..1270457 (+ strand)
Length: 154
Type: CDS
Source: GLEAN
Position: GCSC_97:1270532..1271107 (+ strand)
Length: 576
Type: CDS
Source: GLEAN
Position: GCSC_97:1271173..1272700 (+ strand)
Length: 1528
Type: CDS
Source: GLEAN
Position: GCSC_97:1272760..1272901 (+ strand)
Length: 142
>GLEAN_661 class=GenePrediction position=GCSC_97:1270304..1272901 (+ strand)
ATGCCTGGTGCAAGCGTTGCCGTTATGCCCACTACCGGCTCGCCGGCCCCTGCCACGCGGAAGCCCTCACTCGCACCGGA
GAGGAAGTACAAATGCCAGTTCTGCAACCGAGCATTTAGTAGAAGTGAACATCGCAGCCGCCATGAGCGATCGCGTAAGT
AGACCATGAGGAGAGACGGCATTGTCTTTGCTTAGCTCTCAGATCAGATTGACTGACCGCTTCTTCAGATACCAAGGAGA
GGCCGTTTAAGTGCATGAAGTGTCGGAGCACATTTGTGCGCCGCGATCTTCTTCTCCGCCATGACCGGACCGTTCACGCC
AAAGATGGTGGTGTTCCCTTGCACAGTGATGGAAAGCGCCGTGGCGGAGGTGTGACGAAGACGCGCGCCGTCAGCGGTCC
GTCCAAGTCTATCGCCGCCATTGACACGGCTGCGATCGAGCAACTGGAGGCAAGCAGCGAGGGGATCTTTGATGTCGAAA
CTGCTGCTATGTTGGTGGCAGATCTGCACCACAAGGCCACGGCGTCTGCTCGTCCCAATGGCAGTTCGTACGAAAGTAGC
ACTGGCCTTCCCTCCTACTCCCAGAACGGGTCCGCCATGATGGAACCAGCTGTCACTTATCCGTCCGGTGCCATTGCTAT
TCCCCAATGGGACTCGTTTTTGGCACAGTCTGTGGATTCAAAGTCCCACTCCATCGCCTCGAGTACTTCTGGTGCTTACG
ATACTCAGCCGCCGTATACCCTCTCCAACGCCAATCAGGCTCTGTCGGCTGCGCTGCCACCCATGGCTGGTCACAATATG
AATGGTTTGTGCCCTGTGTCTCATCTTGATTGAGCCCAAGACAATCGACTAACTTTTGTCTTTCTCCAGGGTCTGCCGCA
TCACCTTCGCCGTACCAGTCAGACCGCCAGCACAGTCCTGAGCTGCCCCCGGCACCCACCGGCTTTAAGCTGCCCCAGGT
TAACAGTGATGACGAGCGCAACATCATCCTGGACAACATTCGGAACGGTGACTCGGAGCATGCCCTTCCAGAAGGCTTTC
GTGTGCCTACCCTCGCGGCCATCAACCGTTATCTGTCAACGTACTTCGGTCTGTTCCACCACCACCTGCCTTTCCTGCAT
CCGGCATCCTTCGACCCGTCGAAGACATCGCCTTCGATGTTGTTGGCAGTCTTGTCAATCGGTGCTTTGTATGCCTTTGA
TCAAGAACAGGCTTATATCCTACACATTGGATCTAAAGTACTGGTGAACCAGTTTCTGCAGCACAAGGAGAACTTCAGCT
CGCGCAAATGCCCGCTTTGGACCATGCAGAGCTCTCTGCTGAACATGATCTTTTCAAGCTGGAGCGGTGACCCGAAGGGT
CTGGAGTGGGCCTGCTCCATCAAGAGCCTGCTCGCAAACATGGTTTCTGGCAACCGCTACGAATTGAAGCTTAGACAGGA
AGCTCGGGAGGGCCGACCGCCAACAAGGACTGAATGGGTTGAGGACGAGGGCTGCCGTCGTACCTACTATGCAGTCTACA
TCTTTTTCGGTCTGTTGACGCTCTCGTACAACCACACTCCCGCCATCAGCTTCAATGAGTTCGAGGATCTCCTGTTGCCG
TCTACGGAGGCTCTATGGAACCTGCAAGTGGCGGACGAGGTCTCATGGCAGGAACAGCTCAAGTCGGCAACCAACGTGAC
AATTATGGAAGCCCATGATAATCTGTTTCAGGGCGAGCCTTTGAAGTACAGCGCCTTTGCTACGCGTGTAATGATCAATG
CCCTCTTCCTCGAAGTGTGGTACCACAAGCGCAGTCCGGAAGCTCTACAGGATGTGGTCACTGAATACAAGCTTCGCCTG
GCTCTGGAGACGTGGGAGAAATCCCTCGAGCTCTGCGAGCCTGAAGCTTCATCAGTTTCATTGAGTGCACCGCACAAAGG
GCACCCGCTGACCTTCAATGCGAAGGCCATGTATCGCAATGCGCGTGCACGGCTAGAGGTTGATCTGAAGACAGTGCAGG
AGGCTCTGCGCTACCATGACTCGTACGAAGTGGCGGCTGCAATGTCCAACGCGCGCGACAAGGTCAAGCGCTCGAGCGAA
ATGTTGAAGGTCATCCAGGAGTGCTACAACTGCATCGAGACCGCTGTGGTTCAGGGCGTACGCTGGGTTGCCCGGACCTC
GCCGACAAACTGGAGCATCGAGCACCCATTGTGCGGCATGGATCTCATGATCATTCTCAGCCTCTGGCTCTATCGCCTGG
AACATGACGAAGAGCCGGCTACGGATGAGGAGTTGAAGATGTACGATCAGATCCGGCAACTGTTCGACAAGGACCTCGAA
GAGGCGTTTGCTTCGCAACTGAGCTCGATTGTGGCCCGGCTGTGGGGCTCAATGCTTGATGAGGTTGTGGTTTGGGGGTA
CGTACTTTTCTCTTTTCGCCGTACTTTTGAGCGAGTGGCTAACATTAGCATTGCAGCATTACACGACTCATGGGCGAGTC
GTTCCGACTTCACTCGCAGGCCCTTGTAGGCTATGTGGATGACATCGAAGCGTCCTCTGGTGTCTCGACACCGTCCATGA
CGTCACAAGGCGCTGATGAGGATAGCGTGTGCTATTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62